Incidental Mutation 'R1812:Svil'
ID202517
Institutional Source Beutler Lab
Gene Symbol Svil
Ensembl Gene ENSMUSG00000024236
Gene Namesupervillin
SynonymsB430302E16Rik
MMRRC Submission 039840-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.357) question?
Stock #R1812 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location4920540-5119299 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 5097545 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1676 (Y1676F)
Ref Sequence ENSEMBL: ENSMUSP00000147843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]
Predicted Effect probably damaging
Transcript: ENSMUST00000025079
AA Change: Y1589F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: Y1589F

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125512
AA Change: Y575F
SMART Domains Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236
AA Change: Y575F

DomainStartEndE-ValueType
low complexity region 168 178 N/A INTRINSIC
GEL 384 483 4.58e-22 SMART
GEL 508 625 4.03e-1 SMART
Blast:GEL 695 733 1e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000126977
AA Change: Y1589F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: Y1589F

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127297
AA Change: Y1475F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: Y1475F

DomainStartEndE-ValueType
low complexity region 1067 1077 N/A INTRINSIC
GEL 1283 1382 4.58e-22 SMART
GEL 1407 1524 4.03e-1 SMART
GEL 1594 1704 2.93e-20 SMART
low complexity region 1711 1717 N/A INTRINSIC
GEL 1723 1824 1.72e-17 SMART
GEL 1857 1964 1.37e0 SMART
VHP 2021 2056 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131609
AA Change: Y1589F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: Y1589F

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 2.9e-24 SMART
GEL 1521 1638 2.5e-3 SMART
GEL 1708 1818 1.9e-22 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.1e-19 SMART
low complexity region 1965 1974 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139761
Predicted Effect probably damaging
Transcript: ENSMUST00000140448
AA Change: Y1589F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: Y1589F

DomainStartEndE-ValueType
low complexity region 1181 1191 N/A INTRINSIC
GEL 1397 1496 4.58e-22 SMART
GEL 1521 1638 4.03e-1 SMART
GEL 1708 1818 2.93e-20 SMART
low complexity region 1825 1831 N/A INTRINSIC
GEL 1837 1938 1.72e-17 SMART
GEL 1971 2078 1.37e0 SMART
VHP 2135 2170 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143254
AA Change: Y1185F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: Y1185F

DomainStartEndE-ValueType
low complexity region 777 787 N/A INTRINSIC
GEL 993 1092 4.58e-22 SMART
GEL 1117 1234 4.03e-1 SMART
GEL 1304 1414 2.93e-20 SMART
low complexity region 1421 1427 N/A INTRINSIC
GEL 1433 1534 1.72e-17 SMART
GEL 1567 1674 1.37e0 SMART
VHP 1731 1766 1.15e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000210707
AA Change: Y1676F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.3%
  • 10x: 93.2%
  • 20x: 85.7%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,257,457 Q545* probably null Het
Aadacl2 T C 3: 60,025,077 C338R probably damaging Het
Abcb4 G A 5: 8,928,578 probably null Het
Adam17 T C 12: 21,361,767 D41G probably damaging Het
Angptl7 T A 4: 148,498,083 I119F probably damaging Het
Arid1b T A 17: 5,337,029 S1586T probably benign Het
Arid4b C T 13: 14,195,429 A1170V probably damaging Het
Atad5 A G 11: 80,133,047 T1659A probably damaging Het
Bub1b T G 2: 118,632,421 D754E probably benign Het
Cdkn1a T C 17: 29,098,565 V53A probably benign Het
Chsy1 T G 7: 66,171,817 V600G probably benign Het
Cntrl G A 2: 35,149,469 V561M probably damaging Het
Col6a5 A G 9: 105,928,054 C1218R unknown Het
Crhr1 T C 11: 104,169,147 L140P probably damaging Het
Cyb5b CAGAG CAG 8: 107,170,388 probably null Het
Cyp3a59 A T 5: 146,102,811 Q298L probably damaging Het
Dctn1 A G 6: 83,192,518 E638G possibly damaging Het
Ddx41 A G 13: 55,535,954 I88T probably benign Het
Diaph1 G T 18: 37,891,018 P589Q unknown Het
Dip2b C A 15: 100,198,938 probably null Het
Dscaml1 G A 9: 45,751,286 probably null Het
Dync1h1 C T 12: 110,662,900 A4246V possibly damaging Het
E330009J07Rik A G 6: 40,409,431 I288T probably benign Het
Epb41l1 T C 2: 156,496,511 I158T probably damaging Het
Fat1 A G 8: 45,036,803 Y3584C probably damaging Het
Fxyd5 T A 7: 31,037,930 probably null Het
Gapvd1 T A 2: 34,725,064 K336* probably null Het
Gm9637 G A 14: 19,402,395 noncoding transcript Het
Gpr65 C T 12: 98,275,742 T218M probably damaging Het
Gsdma3 T C 11: 98,632,393 V203A probably damaging Het
Helb T A 10: 120,089,566 K969* probably null Het
Hipk2 G A 6: 38,698,163 A1188V probably benign Het
Itpk1 T A 12: 102,574,058 E255D probably benign Het
Kif21a T C 15: 90,971,766 D596G possibly damaging Het
Kif5a A T 10: 127,242,010 I405N probably benign Het
Klk11 T A 7: 43,777,755 probably null Het
Luzp1 T A 4: 136,542,331 L622M probably benign Het
Macf1 T A 4: 123,432,024 I5227F probably damaging Het
Mapk10 A C 5: 102,913,262 S470A probably damaging Het
Morc2a C T 11: 3,685,831 T897I probably damaging Het
Nmbr A G 10: 14,760,539 probably null Het
Nosip T A 7: 45,076,574 M214K probably damaging Het
Olfr1136 A G 2: 87,693,103 F260L probably benign Het
Olfr159 G T 4: 43,770,230 Y260* probably null Het
Olfr553 A T 7: 102,614,370 N206K possibly damaging Het
Olfr569 T C 7: 102,888,078 Y25C probably benign Het
Pik3c2a A T 7: 116,417,664 V286E probably damaging Het
Ppfia4 T A 1: 134,324,573 I388F probably benign Het
Ppm1f A G 16: 16,917,787 H289R probably damaging Het
Ptprz1 T A 6: 22,959,712 D69E probably benign Het
Rad54b A T 4: 11,612,770 T801S probably damaging Het
Ramp1 A T 1: 91,196,857 N47Y probably damaging Het
Rnf32 T A 5: 29,206,260 H181Q possibly damaging Het
Rpa2 T C 4: 132,768,685 F6L probably benign Het
Ryr2 C A 13: 11,560,586 R4842L probably damaging Het
Scn11a G T 9: 119,780,865 C972* probably null Het
Setd2 C T 9: 110,550,102 T995I probably damaging Het
Slc39a7 A G 17: 34,028,815 L471P probably damaging Het
Slc6a21 C G 7: 45,282,947 S350R probably damaging Het
Slx4ip A G 2: 137,068,195 N300S probably benign Het
Spef2 G A 15: 9,679,349 P634L probably damaging Het
Stk32b G A 5: 37,466,758 A215V probably damaging Het
Tanc1 G A 2: 59,791,679 V381M probably damaging Het
Tanc2 T C 11: 105,886,386 F797L probably benign Het
Tas2r120 T G 6: 132,657,601 C215W probably benign Het
Tenm4 G A 7: 96,895,940 D2388N probably damaging Het
Thsd4 C T 9: 60,056,937 S64N probably damaging Het
Thsd7b C T 1: 129,758,610 R630C probably damaging Het
Top3a A G 11: 60,759,362 I145T probably damaging Het
Vmn2r78 A G 7: 86,920,787 D171G probably benign Het
Vmn2r82 A G 10: 79,379,212 E343G probably benign Het
Wdr70 T C 15: 8,079,179 D161G probably benign Het
Other mutations in Svil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Svil APN 18 5099045 missense probably benign 0.27
IGL00840:Svil APN 18 5063555 missense probably benign
IGL01329:Svil APN 18 5064501 missense probably benign
IGL01446:Svil APN 18 5062385 missense probably damaging 1.00
IGL02068:Svil APN 18 5092899 missense probably damaging 1.00
IGL02223:Svil APN 18 5105879 splice site probably benign
IGL02428:Svil APN 18 5118203 missense probably damaging 1.00
IGL02429:Svil APN 18 5118369 missense probably benign 0.00
IGL02479:Svil APN 18 5099476 missense probably damaging 1.00
IGL02560:Svil APN 18 5049379 missense probably benign 0.00
IGL02652:Svil APN 18 5114531 missense probably damaging 1.00
IGL03291:Svil APN 18 5056150 nonsense probably null
IGL03055:Svil UTSW 18 5108615 missense probably damaging 1.00
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0029:Svil UTSW 18 5063286 missense probably benign 0.14
R0266:Svil UTSW 18 5099063 splice site probably benign
R0281:Svil UTSW 18 5094582 missense probably damaging 1.00
R0442:Svil UTSW 18 5046870 missense probably damaging 1.00
R0549:Svil UTSW 18 5064566 missense possibly damaging 0.79
R0617:Svil UTSW 18 5117002 missense probably damaging 1.00
R0801:Svil UTSW 18 5099443 missense probably benign 0.00
R0894:Svil UTSW 18 5097494 missense probably damaging 1.00
R1053:Svil UTSW 18 5056690 missense probably benign 0.16
R1065:Svil UTSW 18 5063777 splice site probably benign
R1080:Svil UTSW 18 5058147 missense possibly damaging 0.79
R1199:Svil UTSW 18 5059217 splice site probably benign
R1472:Svil UTSW 18 5048950 missense probably benign 0.09
R1480:Svil UTSW 18 5057345 missense probably damaging 1.00
R1544:Svil UTSW 18 5046817 missense possibly damaging 0.93
R1626:Svil UTSW 18 5117099 critical splice donor site probably null
R1691:Svil UTSW 18 5056336 missense probably benign 0.06
R1826:Svil UTSW 18 5063383 missense probably benign 0.01
R1842:Svil UTSW 18 5062373 missense probably damaging 1.00
R1884:Svil UTSW 18 5094640 missense possibly damaging 0.94
R1945:Svil UTSW 18 5117059 missense probably damaging 1.00
R2184:Svil UTSW 18 5099534 missense probably damaging 1.00
R2184:Svil UTSW 18 5099615 missense probably damaging 1.00
R2232:Svil UTSW 18 5046640 start codon destroyed probably null 0.98
R2398:Svil UTSW 18 5060613 splice site probably null
R3076:Svil UTSW 18 5116055 missense probably damaging 1.00
R3777:Svil UTSW 18 5090855 missense probably damaging 0.97
R3779:Svil UTSW 18 5090855 missense probably damaging 0.97
R3797:Svil UTSW 18 5060534 missense probably benign 0.29
R4077:Svil UTSW 18 5063522 missense probably benign 0.03
R4350:Svil UTSW 18 5118154 missense probably damaging 1.00
R4379:Svil UTSW 18 5046909 missense probably damaging 1.00
R4488:Svil UTSW 18 5049067 missense probably damaging 1.00
R4777:Svil UTSW 18 5088813 missense probably damaging 0.99
R4825:Svil UTSW 18 5114564 missense probably damaging 1.00
R4921:Svil UTSW 18 5108631 missense probably damaging 1.00
R4969:Svil UTSW 18 5095516 missense probably damaging 1.00
R4975:Svil UTSW 18 5054025 missense possibly damaging 0.61
R4990:Svil UTSW 18 5056810 missense probably benign 0.05
R4991:Svil UTSW 18 5056810 missense probably benign 0.05
R5061:Svil UTSW 18 5048954 missense probably benign 0.02
R5271:Svil UTSW 18 5062329 missense probably benign 0.45
R5362:Svil UTSW 18 5057345 missense probably damaging 1.00
R5433:Svil UTSW 18 5059294 missense probably damaging 0.99
R5677:Svil UTSW 18 5046823 nonsense probably null
R5850:Svil UTSW 18 5098900 splice site probably null
R5868:Svil UTSW 18 5056854 splice site probably null
R5871:Svil UTSW 18 5103669 unclassified probably null
R5876:Svil UTSW 18 5082828 missense probably damaging 1.00
R6061:Svil UTSW 18 5106724 missense probably damaging 1.00
R6062:Svil UTSW 18 5106724 missense probably damaging 1.00
R6063:Svil UTSW 18 5106724 missense probably damaging 1.00
R6065:Svil UTSW 18 5106724 missense probably damaging 1.00
R6066:Svil UTSW 18 5106724 missense probably damaging 1.00
R6114:Svil UTSW 18 5108639 missense probably damaging 1.00
R6115:Svil UTSW 18 5108675 missense probably damaging 0.99
R6117:Svil UTSW 18 5116016 missense probably damaging 1.00
R6302:Svil UTSW 18 5057432 missense probably benign 0.13
R6418:Svil UTSW 18 5040171 missense probably benign 0.26
R6441:Svil UTSW 18 5049323 missense probably benign
R6446:Svil UTSW 18 5057323 missense probably benign 0.09
R6455:Svil UTSW 18 5056629 missense possibly damaging 0.89
R6545:Svil UTSW 18 5108621 missense probably benign 0.00
R6692:Svil UTSW 18 5082853 missense probably damaging 1.00
R6730:Svil UTSW 18 5049311 missense probably benign 0.17
R6763:Svil UTSW 18 5056437 missense probably damaging 0.99
R6870:Svil UTSW 18 5063231 missense possibly damaging 0.86
X0065:Svil UTSW 18 5062317 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCAGCGTTCAGAAGATG -3'
(R):5'- GAAAGCTAACCCTCCTAGGC -3'

Sequencing Primer
(F):5'- CCAGCGTTCAGAAGATGATGTC -3'
(R):5'- CCGCAGCACGTAAGCATTTC -3'
Posted On2014-06-23