Incidental Mutation 'R0092:Dnajc10'
ID20255
Institutional Source Beutler Lab
Gene Symbol Dnajc10
Ensembl Gene ENSMUSG00000027006
Gene NameDnaJ heat shock protein family (Hsp40) member C10
SynonymsJPDI, ERdj5, D2Ertd706e, 1200006L06Rik
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R0092 (G1)
Quality Score208
Status Validated (trace)
Chromosome2
Chromosomal Location80315466-80354043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80325682 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 233 (V233A)
Ref Sequence ENSEMBL: ENSMUSP00000028392 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028392]
PDB Structure
Crystal structure of full-length ERdj5 [X-RAY DIFFRACTION]
Crystal structure of J-Trx1 fragment of ERdj5 [X-RAY DIFFRACTION]
Crystal structure of Trx4 domain of ERdj5 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028392
AA Change: V233A

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028392
Gene: ENSMUSG00000027006
AA Change: V233A

DomainStartEndE-ValueType
DnaJ 34 92 9.73e-26 SMART
Pfam:Thioredoxin 130 232 5.6e-21 PFAM
low complexity region 384 392 N/A INTRINSIC
Pfam:Thioredoxin 454 553 2.3e-21 PFAM
Pfam:Thioredoxin 557 663 2e-21 PFAM
Pfam:Thioredoxin 672 776 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125000
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endoplasmic reticulum co-chaperone which is part of the endoplasmic reticulum-associated degradation complex involved in recognizing and degrading misfolded proteins. The encoded protein reduces incorrect disulfide bonds in misfolded glycoproteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased endoplasmic reticulum stress in the salivary gland. Female homozygous mutant mice are smaller than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Dnajc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Dnajc10 APN 2 80324752 splice site probably benign
IGL01420:Dnajc10 APN 2 80345023 missense possibly damaging 0.81
IGL01466:Dnajc10 APN 2 80321287 missense probably benign 0.00
IGL01645:Dnajc10 APN 2 80340527 missense possibly damaging 0.46
IGL01929:Dnajc10 APN 2 80328076 missense probably damaging 0.99
IGL01958:Dnajc10 APN 2 80321304 splice site probably benign
IGL02205:Dnajc10 APN 2 80349358 missense possibly damaging 0.74
IGL02289:Dnajc10 APN 2 80340526 missense probably damaging 0.98
IGL02661:Dnajc10 APN 2 80326740 splice site probably benign
IGL02865:Dnajc10 APN 2 80331303 missense probably benign
IGL03026:Dnajc10 APN 2 80349303 missense probably damaging 0.96
IGL03407:Dnajc10 APN 2 80346641 missense probably damaging 1.00
R0457:Dnajc10 UTSW 2 80344946 missense possibly damaging 0.65
R1414:Dnajc10 UTSW 2 80347677 missense probably damaging 0.99
R1739:Dnajc10 UTSW 2 80347662 missense probably benign 0.03
R2126:Dnajc10 UTSW 2 80350734 critical splice donor site probably null
R3717:Dnajc10 UTSW 2 80324745 splice site probably benign
R3718:Dnajc10 UTSW 2 80324745 splice site probably benign
R4020:Dnajc10 UTSW 2 80344952 missense probably damaging 1.00
R4453:Dnajc10 UTSW 2 80346623 missense probably damaging 0.98
R4585:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4586:Dnajc10 UTSW 2 80347778 missense probably damaging 1.00
R4772:Dnajc10 UTSW 2 80340526 missense probably damaging 0.98
R5653:Dnajc10 UTSW 2 80349368 missense probably damaging 1.00
R6157:Dnajc10 UTSW 2 80317391 start gained probably benign
R6263:Dnajc10 UTSW 2 80343948 missense probably damaging 1.00
R6303:Dnajc10 UTSW 2 80350664 missense probably benign 0.07
R6932:Dnajc10 UTSW 2 80331336 missense probably benign
X0018:Dnajc10 UTSW 2 80350674 missense probably damaging 0.97
X0024:Dnajc10 UTSW 2 80344962 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- AGTTAACAGCTACCCCAGCCTCTTC -3'
(R):5'- CCTGAGCAGTGACACACTTCCTTTC -3'

Sequencing Primer
(F):5'- GGACCATCAGTTCCTGTCATAAAG -3'
(R):5'- TCTAAGAAGTGCAGAAAAAGATACTG -3'
Posted On2013-04-11