Incidental Mutation 'R1815:Srsf11'
ID202610
Institutional Source Beutler Lab
Gene Symbol Srsf11
Ensembl Gene ENSMUSG00000055436
Gene Nameserine/arginine-rich splicing factor 11
Synonyms0610009J05Rik, Sfrs11, 2610019N13Rik
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location158010473-158036639 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 158016427 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122686 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069025] [ENSMUST00000072875] [ENSMUST00000121326] [ENSMUST00000126716] [ENSMUST00000137444] [ENSMUST00000198705]
Predicted Effect unknown
Transcript: ENSMUST00000069025
AA Change: R286Q
SMART Domains Protein: ENSMUSP00000063916
Gene: ENSMUSG00000055436
AA Change: R286Q

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 271 310 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
low complexity region 365 374 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000072875
AA Change: R269Q
SMART Domains Protein: ENSMUSP00000072651
Gene: ENSMUSG00000055436
AA Change: R269Q

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 239 317 N/A INTRINSIC
low complexity region 327 409 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 465 474 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000121326
AA Change: R304Q
SMART Domains Protein: ENSMUSP00000113685
Gene: ENSMUSG00000055436
AA Change: R304Q

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 40 59 N/A INTRINSIC
RRM 62 136 3.13e-7 SMART
low complexity region 152 176 N/A INTRINSIC
low complexity region 179 202 N/A INTRINSIC
low complexity region 274 352 N/A INTRINSIC
low complexity region 362 444 N/A INTRINSIC
low complexity region 463 470 N/A INTRINSIC
low complexity region 500 509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126377
Predicted Effect probably benign
Transcript: ENSMUST00000126716
SMART Domains Protein: ENSMUSP00000114370
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127778
Predicted Effect probably benign
Transcript: ENSMUST00000137444
SMART Domains Protein: ENSMUSP00000122686
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 5 24 N/A INTRINSIC
RRM 27 101 3.13e-7 SMART
low complexity region 117 141 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152274
SMART Domains Protein: ENSMUSP00000127239
Gene: ENSMUSG00000055436

DomainStartEndE-ValueType
low complexity region 64 88 N/A INTRINSIC
low complexity region 91 114 N/A INTRINSIC
low complexity region 186 264 N/A INTRINSIC
low complexity region 274 356 N/A INTRINSIC
low complexity region 375 382 N/A INTRINSIC
low complexity region 412 421 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156303
Predicted Effect unknown
Transcript: ENSMUST00000198705
AA Change: R111Q
SMART Domains Protein: ENSMUSP00000142759
Gene: ENSMUSG00000055436
AA Change: R111Q

DomainStartEndE-ValueType
low complexity region 81 175 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199520
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Srsf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01598:Srsf11 APN 3 158012035 unclassified probably benign
IGL01600:Srsf11 APN 3 158019442 splice site probably benign
IGL02724:Srsf11 APN 3 158016431 unclassified probably benign
IGL03147:Srsf11 UTSW 3 158026740 missense probably damaging 1.00
R0195:Srsf11 UTSW 3 158036535 unclassified probably benign
R0578:Srsf11 UTSW 3 158012067 unclassified probably benign
R0580:Srsf11 UTSW 3 158012067 unclassified probably benign
R1075:Srsf11 UTSW 3 158012790 intron probably benign
R1604:Srsf11 UTSW 3 158019311 critical splice donor site probably null
R1797:Srsf11 UTSW 3 158019428 missense possibly damaging 0.92
R1899:Srsf11 UTSW 3 158031580 unclassified probably benign
R2105:Srsf11 UTSW 3 158019345 missense probably damaging 0.99
R4605:Srsf11 UTSW 3 158022923 nonsense probably null
R4655:Srsf11 UTSW 3 158023335 missense probably benign 0.15
R4737:Srsf11 UTSW 3 158026732 nonsense probably null
R5244:Srsf11 UTSW 3 158023344 unclassified probably benign
R5245:Srsf11 UTSW 3 158023344 unclassified probably benign
R5379:Srsf11 UTSW 3 158023344 unclassified probably benign
R5401:Srsf11 UTSW 3 158023344 unclassified probably benign
R5625:Srsf11 UTSW 3 158023344 unclassified probably benign
R5763:Srsf11 UTSW 3 158023344 unclassified probably benign
R5814:Srsf11 UTSW 3 158023344 unclassified probably benign
R5938:Srsf11 UTSW 3 158023344 unclassified probably benign
R5944:Srsf11 UTSW 3 158023344 unclassified probably benign
R5945:Srsf11 UTSW 3 158023344 unclassified probably benign
R6126:Srsf11 UTSW 3 158023344 unclassified probably benign
R6175:Srsf11 UTSW 3 158023344 unclassified probably benign
R6427:Srsf11 UTSW 3 158023344 unclassified probably benign
R6435:Srsf11 UTSW 3 158023344 unclassified probably benign
R6436:Srsf11 UTSW 3 158023344 unclassified probably benign
R6614:Srsf11 UTSW 3 158023344 unclassified probably benign
R6616:Srsf11 UTSW 3 158023344 unclassified probably benign
X0017:Srsf11 UTSW 3 158016349 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AACAAAGAAGCCTGGCACTG -3'
(R):5'- AGACTCTCAGTTGTATACACAAGC -3'

Sequencing Primer
(F):5'- GCACTGGGGTTTCAGGAAC -3'
(R):5'- CTCAGTTGTATACACAAGCACAAGTG -3'
Posted On2014-06-23