Incidental Mutation 'R1815:Vgll4'
ID202620
Institutional Source Beutler Lab
Gene Symbol Vgll4
Ensembl Gene ENSMUSG00000030315
Gene Namevestigial like family member 4
SynonymsVGL-4
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.417) question?
Stock #R1815 (G1)
Quality Score209
Status Not validated
Chromosome6
Chromosomal Location114860628-114969994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114864059 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000118618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000032459] [ENSMUST00000139640] [ENSMUST00000147639] [ENSMUST00000169310] [ENSMUST00000182428] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
Predicted Effect probably benign
Transcript: ENSMUST00000032457
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000032459
AA Change: D98G

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000032459
Gene: ENSMUSG00000030315
AA Change: D98G

DomainStartEndE-ValueType
TDU 203 218 5.27e-4 SMART
TDU 231 246 9.84e-4 SMART
low complexity region 251 264 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123478
Predicted Effect probably benign
Transcript: ENSMUST00000139640
AA Change: D92G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118618
Gene: ENSMUSG00000030315
AA Change: D92G

DomainStartEndE-ValueType
Pfam:VGLL4 4 189 1.1e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147639
AA Change: D92G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000123139
Gene: ENSMUSG00000030315
AA Change: D92G

DomainStartEndE-ValueType
TDU 197 212 5.27e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152710
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155620
Predicted Effect probably benign
Transcript: ENSMUST00000169310
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182428
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182793
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182860
Predicted Effect probably benign
Transcript: ENSMUST00000182902
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182934
Predicted Effect probably benign
Transcript: ENSMUST00000183165
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Vgll4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01454:Vgll4 APN 6 114863996 missense probably benign 0.10
IGL02080:Vgll4 APN 6 114862798 missense probably damaging 1.00
IGL02551:Vgll4 APN 6 114862293 missense probably damaging 1.00
R0946:Vgll4 UTSW 6 114890807 critical splice acceptor site probably null
R0946:Vgll4 UTSW 6 114890808 critical splice acceptor site probably null
R1710:Vgll4 UTSW 6 114957934 critical splice donor site probably null
R1843:Vgll4 UTSW 6 114862795 missense probably benign 0.22
R1922:Vgll4 UTSW 6 114921335 missense probably benign 0.29
R4407:Vgll4 UTSW 6 114890612 splice site probably null
R5147:Vgll4 UTSW 6 114890615 critical splice donor site probably null
R5714:Vgll4 UTSW 6 114890776 missense possibly damaging 0.70
R6080:Vgll4 UTSW 6 114921338 missense probably benign 0.29
R6954:Vgll4 UTSW 6 114921367 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAACATCCAGCCTGATATGG -3'
(R):5'- AGGTGCCTCTCCTATACTCAG -3'

Sequencing Primer
(F):5'- TGATATGGCCACCTCCAGATG -3'
(R):5'- CCTATACTCAGGGCGTGGTTC -3'
Posted On2014-06-23