Incidental Mutation 'R0092:Frem2'
ID20263
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0092 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53589796 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1766 (Y1766H)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably benign
Transcript: ENSMUST00000091137
AA Change: Y1766H

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: Y1766H

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4661:Frem2 UTSW 3 53655443 missense probably damaging 1.00
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCACACTCATGCACCTTGACAC -3'
(R):5'- AGGTTAGCTCCATCTCCATGCACG -3'

Sequencing Primer
(F):5'- GATCTCTTCGTAGCCAAAAATCAG -3'
(R):5'- GCCCTGGAGTTGCATATTAAATCC -3'
Posted On2013-04-11