Incidental Mutation 'R1815:Fanci'
ID202630
Institutional Source Beutler Lab
Gene Symbol Fanci
Ensembl Gene ENSMUSG00000039187
Gene NameFanconi anemia, complementation group I
Synonyms
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location79391929-79450264 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79438308 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 903 (I903N)
Ref Sequence ENSEMBL: ENSMUSP00000044931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036865] [ENSMUST00000132091] [ENSMUST00000137667]
PDB Structure
Structure of the FANCI-FANCD2 complex [X-RAY DIFFRACTION]
Structure of a Y DNA-FANCI complex [X-RAY DIFFRACTION]
Structure of FANCI [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000036865
AA Change: I903N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000044931
Gene: ENSMUSG00000039187
AA Change: I903N

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 7.5e-27 PFAM
Pfam:FANCI_S1 62 280 3.5e-78 PFAM
Pfam:FANCI_HD1 284 370 1.6e-37 PFAM
Pfam:FANCI_S2 378 540 2.4e-63 PFAM
Pfam:FANCI_HD2 554 785 4.8e-87 PFAM
Pfam:FANCI_S3 803 1028 1.7e-83 PFAM
Pfam:FANCI_S4 1041 1295 1.3e-95 PFAM
low complexity region 1299 1307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132091
SMART Domains Protein: ENSMUSP00000122113
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 53 1.6e-29 PFAM
Pfam:FANCI_S1 60 281 3.2e-81 PFAM
Pfam:FANCI_HD1 284 371 2.9e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137667
SMART Domains Protein: ENSMUSP00000117992
Gene: ENSMUSG00000039187

DomainStartEndE-ValueType
Pfam:FANCI_S1-cap 1 25 7.2e-11 PFAM
Pfam:FANCI_S1 32 253 3.4e-80 PFAM
Pfam:FANCI_HD1 256 343 7.3e-37 PFAM
Pfam:FANCI_S2 349 513 8.5e-56 PFAM
Pfam:FANCI_HD2 523 758 9.3e-99 PFAM
Pfam:FANCI_S3 775 850 1.3e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206121
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group I. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Fanci
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00717:Fanci APN 7 79412700 missense probably damaging 1.00
IGL00718:Fanci APN 7 79444174 missense possibly damaging 0.92
IGL00764:Fanci APN 7 79395912 start codon destroyed probably null 0.05
IGL01669:Fanci APN 7 79449177 missense probably benign 0.01
IGL02338:Fanci APN 7 79433531 nonsense probably null
IGL02428:Fanci APN 7 79444516 intron probably benign
IGL03029:Fanci APN 7 79443999 missense probably benign 0.00
P0023:Fanci UTSW 7 79402300 missense probably benign 0.00
P0047:Fanci UTSW 7 79444044 missense probably damaging 1.00
R0310:Fanci UTSW 7 79407417 splice site probably benign
R0388:Fanci UTSW 7 79439630 missense probably benign
R0506:Fanci UTSW 7 79432178 missense probably benign 0.29
R0570:Fanci UTSW 7 79443963 missense probably damaging 1.00
R0631:Fanci UTSW 7 79406205 missense probably damaging 1.00
R0746:Fanci UTSW 7 79439681 missense probably damaging 0.99
R0981:Fanci UTSW 7 79405166 missense probably benign 0.01
R1559:Fanci UTSW 7 79433193 missense probably damaging 1.00
R1656:Fanci UTSW 7 79405188 splice site probably benign
R1748:Fanci UTSW 7 79430488 missense probably damaging 1.00
R2164:Fanci UTSW 7 79395995 missense probably benign 0.22
R3508:Fanci UTSW 7 79433472 missense probably benign 0.01
R3908:Fanci UTSW 7 79433509 missense possibly damaging 0.91
R4036:Fanci UTSW 7 79444822 missense probably damaging 1.00
R4066:Fanci UTSW 7 79412757 critical splice donor site probably null
R4633:Fanci UTSW 7 79427242 missense probably damaging 1.00
R4651:Fanci UTSW 7 79435256 missense possibly damaging 0.74
R4993:Fanci UTSW 7 79435378 makesense probably null
R5341:Fanci UTSW 7 79406178 missense probably damaging 1.00
R5806:Fanci UTSW 7 79448848 missense probably damaging 0.97
R5898:Fanci UTSW 7 79433321 missense probably benign
R5919:Fanci UTSW 7 79444738 missense probably damaging 1.00
R5960:Fanci UTSW 7 79443762 missense probably damaging 1.00
R6367:Fanci UTSW 7 79426195 missense probably damaging 0.99
R6436:Fanci UTSW 7 79440698 missense probably benign 0.03
R6468:Fanci UTSW 7 79417939 missense probably benign 0.10
R6508:Fanci UTSW 7 79443768 missense probably damaging 0.99
R6886:Fanci UTSW 7 79420342 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- ATGAGTTGTAAAGCACCCACG -3'
(R):5'- TGCTTAAATGCAATGCAGTGAGC -3'

Sequencing Primer
(F):5'- CCACGTGGGAACAGAAATGAG -3'
(R):5'- AGTCTGGAACCCACTCGAG -3'
Posted On2014-06-23