Incidental Mutation 'R1815:Atp7b'
ID202635
Institutional Source Beutler Lab
Gene Symbol Atp7b
Ensembl Gene ENSMUSG00000006567
Gene NameATPase, Cu++ transporting, beta polypeptide
SynonymsAtp7a, WND, Wilson protein
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.535) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location21992785-22060305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 22011651 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 864 (M864V)
Ref Sequence ENSEMBL: ENSMUSP00000006742 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006742] [ENSMUST00000110738]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006742
AA Change: M864V

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006742
Gene: ENSMUSG00000006567
AA Change: M864V

DomainStartEndE-ValueType
Pfam:HMA 71 132 8.8e-14 PFAM
Pfam:HMA 156 217 6.6e-13 PFAM
Pfam:HMA 271 329 7.4e-13 PFAM
Pfam:HMA 364 425 1.1e-10 PFAM
Pfam:HMA 493 554 2.3e-14 PFAM
Pfam:HMA 569 630 3.1e-15 PFAM
transmembrane domain 656 675 N/A INTRINSIC
Pfam:E1-E2_ATPase 770 1018 3.3e-60 PFAM
Pfam:Hydrolase 1023 1276 1.3e-67 PFAM
Pfam:HAD 1026 1273 4.6e-10 PFAM
Pfam:Hydrolase_3 1243 1308 5.1e-7 PFAM
transmembrane domain 1322 1344 N/A INTRINSIC
low complexity region 1353 1370 N/A INTRINSIC
low complexity region 1418 1437 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110738
AA Change: M749V

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000106366
Gene: ENSMUSG00000006567
AA Change: M749V

DomainStartEndE-ValueType
Pfam:HMA 59 120 1.2e-13 PFAM
Pfam:HMA 144 205 9.7e-12 PFAM
PDB:2AW0|A 259 314 6e-6 PDB
Pfam:HMA 378 439 1.6e-13 PFAM
Pfam:HMA 454 515 1.5e-15 PFAM
transmembrane domain 541 560 N/A INTRINSIC
Pfam:E1-E2_ATPase 656 904 4.6e-50 PFAM
Pfam:Hydrolase 908 1161 6.6e-76 PFAM
Pfam:HAD 911 1158 1.5e-15 PFAM
Pfam:Hydrolase_3 1128 1193 8.5e-7 PFAM
transmembrane domain 1207 1229 N/A INTRINSIC
low complexity region 1238 1255 N/A INTRINSIC
low complexity region 1303 1322 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the P-type cation transport ATPase family and encodes a protein with several membrane-spanning domains, an ATPase consensus sequence, a hinge domain, a phosphorylation site, and at least 2 putative copper-binding sites. This protein functions as a monomer, exporting copper out of the cells, such as the efflux of hepatic copper into the bile. Alternate transcriptional splice variants, encoding different isoforms with distinct cellular localizations, have been characterized. Mutations in this gene have been associated with Wilson disease (WD). [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of the mouse gene results in copper accumulation in various organs, primarily the liver, kidney and brain, and a form of liver cirrhosis that resembles Wilson disease in humans and the 'toxic milk' phenotype in mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Atp7b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00932:Atp7b APN 8 22011098 missense possibly damaging 0.91
IGL00981:Atp7b APN 8 22027527 splice site probably null
IGL01600:Atp7b APN 8 22027525 splice site probably null
IGL01713:Atp7b APN 8 22028573 missense probably damaging 1.00
IGL01778:Atp7b APN 8 21994828 missense probably benign 0.42
IGL01926:Atp7b APN 8 22011781 missense probably damaging 0.98
IGL02312:Atp7b APN 8 21994770 missense probably damaging 0.99
IGL02562:Atp7b APN 8 22028085 missense probably benign
IGL02573:Atp7b APN 8 22022470 missense probably benign 0.00
IGL02603:Atp7b APN 8 21994776 missense possibly damaging 0.88
IGL02622:Atp7b APN 8 22028438 missense possibly damaging 0.69
IGL02721:Atp7b APN 8 22022477 missense probably benign 0.00
IGL03145:Atp7b APN 8 22018143 missense probably damaging 1.00
daffodil UTSW 8 21998266 missense probably damaging 1.00
PIT4131001:Atp7b UTSW 8 21994656 missense probably damaging 1.00
R0023:Atp7b UTSW 8 22011073 missense probably damaging 1.00
R0046:Atp7b UTSW 8 22059995 missense probably benign 0.00
R0128:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0130:Atp7b UTSW 8 22028172 missense possibly damaging 0.47
R0325:Atp7b UTSW 8 22028451 missense probably benign 0.22
R0412:Atp7b UTSW 8 21995659 splice site probably null
R0856:Atp7b UTSW 8 21997631 missense probably damaging 1.00
R0906:Atp7b UTSW 8 22027826 missense probably benign
R0989:Atp7b UTSW 8 22028694 missense possibly damaging 0.51
R1377:Atp7b UTSW 8 22011785 missense probably benign 0.17
R1517:Atp7b UTSW 8 21997358 missense probably damaging 1.00
R1521:Atp7b UTSW 8 22027673 missense probably damaging 0.96
R1529:Atp7b UTSW 8 22028724 missense possibly damaging 0.87
R1691:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R1743:Atp7b UTSW 8 22006387 missense probably damaging 1.00
R2008:Atp7b UTSW 8 22027980 missense probably damaging 1.00
R2133:Atp7b UTSW 8 22011077 missense probably damaging 1.00
R2155:Atp7b UTSW 8 22013584 missense possibly damaging 0.69
R2182:Atp7b UTSW 8 22014547 missense probably damaging 0.99
R2256:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2257:Atp7b UTSW 8 21998266 missense probably damaging 1.00
R2274:Atp7b UTSW 8 22020832 missense probably benign 0.20
R2475:Atp7b UTSW 8 21994776 missense possibly damaging 0.88
R2906:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R2907:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R3421:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3422:Atp7b UTSW 8 22028670 missense probably damaging 1.00
R3688:Atp7b UTSW 8 22004230 missense probably damaging 1.00
R3945:Atp7b UTSW 8 22020864 missense probably benign 0.02
R4235:Atp7b UTSW 8 22011023 missense possibly damaging 0.90
R4700:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4701:Atp7b UTSW 8 22000121 missense probably benign 0.00
R4877:Atp7b UTSW 8 22028601 missense probably damaging 0.98
R4962:Atp7b UTSW 8 22020885 missense probably damaging 1.00
R5009:Atp7b UTSW 8 22027698 missense possibly damaging 0.88
R5016:Atp7b UTSW 8 22015869 splice site probably null
R5038:Atp7b UTSW 8 22028456 missense possibly damaging 0.67
R5438:Atp7b UTSW 8 22014554 missense probably benign
R5467:Atp7b UTSW 8 22011554 missense probably damaging 1.00
R5468:Atp7b UTSW 8 22059970 critical splice donor site probably null
R5512:Atp7b UTSW 8 22012739 missense probably benign 0.20
R5563:Atp7b UTSW 8 22028714 missense possibly damaging 0.82
R5751:Atp7b UTSW 8 22018128 missense probably damaging 1.00
R5773:Atp7b UTSW 8 22027863 missense probably benign
R5941:Atp7b UTSW 8 21997496 missense probably damaging 0.98
R6227:Atp7b UTSW 8 22020825 missense possibly damaging 0.63
R6265:Atp7b UTSW 8 22015927 nonsense probably null
R6290:Atp7b UTSW 8 22020820 missense probably damaging 1.00
R6368:Atp7b UTSW 8 22020755 splice site probably null
R6647:Atp7b UTSW 8 22028478 missense probably damaging 1.00
R6788:Atp7b UTSW 8 22004375 missense probably benign 0.37
R6830:Atp7b UTSW 8 22022365 missense probably damaging 0.97
R6886:Atp7b UTSW 8 22028690 missense probably benign 0.01
R6928:Atp7b UTSW 8 21994812 missense probably benign
R6965:Atp7b UTSW 8 22028085 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGAGCTAAAATCCCTTTGAGATC -3'
(R):5'- ACGTCATCAAGGTTGTCCC -3'

Sequencing Primer
(F):5'- CTTAAAGGAAGGGTTTCATTACGTG -3'
(R):5'- CATCAAGGTTGTCCCTGGGG -3'
Posted On2014-06-23