Incidental Mutation 'R1815:Olfr1537'
ID202640
Institutional Source Beutler Lab
Gene Symbol Olfr1537
Ensembl Gene ENSMUSG00000096109
Gene Nameolfactory receptor 1537
SynonymsMOR171-41P, MOR171-32P, GA_x6K02T2PVTD-32935684-32934749, Olfr1537-ps1, K4, MOR171-32P, Olfr144
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39234412-39249994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39237990 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 145 (I145V)
Ref Sequence ENSEMBL: ENSMUSP00000149992 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073248] [ENSMUST00000213472]
Predicted Effect probably benign
Transcript: ENSMUST00000073248
AA Change: I148V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000072979
Gene: ENSMUSG00000096109
AA Change: I148V

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2.4e-51 PFAM
Pfam:7tm_1 44 293 1.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213472
AA Change: I145V

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Olfr1537
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:Olfr1537 APN 9 39237605 missense probably benign 0.25
IGL01691:Olfr1537 APN 9 39238019 missense probably benign 0.00
IGL02606:Olfr1537 APN 9 39238194 missense probably damaging 0.98
IGL02656:Olfr1537 APN 9 39238160 missense probably benign 0.13
R0133:Olfr1537 UTSW 9 39238011 missense probably benign 0.00
R0548:Olfr1537 UTSW 9 39238371 missense probably benign 0.13
R0558:Olfr1537 UTSW 9 39238200 missense probably damaging 0.96
R0616:Olfr1537 UTSW 9 39237650 missense probably benign 0.00
R0626:Olfr1537 UTSW 9 39237866 missense possibly damaging 0.52
R0826:Olfr1537 UTSW 9 39238429 start codon destroyed probably null 0.00
R0839:Olfr1537 UTSW 9 39237850 missense possibly damaging 0.51
R1074:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1224:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1226:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1252:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1256:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1355:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1356:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1416:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1499:Olfr1537 UTSW 9 39238251 missense probably benign 0.39
R1658:Olfr1537 UTSW 9 39237959 missense probably benign 0.03
R2198:Olfr1537 UTSW 9 39237752 missense possibly damaging 0.48
R4178:Olfr1537 UTSW 9 39238079 nonsense probably null
R5112:Olfr1537 UTSW 9 39238421 start codon destroyed probably null 0.94
R6251:Olfr1537 UTSW 9 39238218 missense possibly damaging 0.94
R6850:Olfr1537 UTSW 9 39237975 missense probably benign 0.01
R7032:Olfr1537 UTSW 9 39237687 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ATAATGGTCAGCACTGGGAC -3'
(R):5'- CTCGTGAGCTTTCTGACAGAGATG -3'

Sequencing Primer
(F):5'- TCAGCACTGGGACAAATGAATTC -3'
(R):5'- GAGCTTTCTGACAGAGATGAACATC -3'
Posted On2014-06-23