Incidental Mutation 'R1815:Jmy'
ID202662
Institutional Source Beutler Lab
Gene Symbol Jmy
Ensembl Gene ENSMUSG00000021690
Gene Namejunction-mediating and regulatory protein
Synonyms
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location93430101-93499808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93454077 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 506 (G506D)
Ref Sequence ENSEMBL: ENSMUSP00000070339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065537]
Predicted Effect probably damaging
Transcript: ENSMUST00000065537
AA Change: G506D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070339
Gene: ENSMUSG00000021690
AA Change: G506D

DomainStartEndE-ValueType
Pfam:WHAMM-JMY_N 5 55 6.2e-30 PFAM
low complexity region 77 94 N/A INTRINSIC
low complexity region 117 128 N/A INTRINSIC
low complexity region 152 181 N/A INTRINSIC
low complexity region 202 217 N/A INTRINSIC
Pfam:JMY 220 574 2.2e-175 PFAM
SCOP:d1jvr__ 794 816 4e-3 SMART
WH2 916 933 2.21e-2 SMART
low complexity region 964 975 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Ccdc112 A T 18: 46,291,106 N188K possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Jmy
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00798:Jmy APN 13 93441402 missense probably benign 0.00
IGL00949:Jmy APN 13 93454002 missense probably damaging 1.00
IGL01111:Jmy APN 13 93441021 missense probably damaging 1.00
IGL01734:Jmy APN 13 93459651 missense probably damaging 1.00
IGL01926:Jmy APN 13 93459786 missense probably damaging 1.00
IGL01985:Jmy APN 13 93459636 missense possibly damaging 0.58
IGL02183:Jmy APN 13 93499242 missense possibly damaging 0.78
IGL02517:Jmy APN 13 93452808 missense probably benign 0.01
IGL02524:Jmy APN 13 93472760 missense probably damaging 1.00
IGL02697:Jmy APN 13 93459701 nonsense probably null
IGL03024:Jmy APN 13 93499199 missense probably damaging 1.00
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0242:Jmy UTSW 13 93441618 missense probably benign 0.07
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0623:Jmy UTSW 13 93452817 missense probably benign 0.37
R0722:Jmy UTSW 13 93452817 missense probably benign 0.37
R1533:Jmy UTSW 13 93441311 missense probably benign
R1667:Jmy UTSW 13 93498370 missense probably damaging 1.00
R1737:Jmy UTSW 13 93498795 missense probably damaging 0.99
R2057:Jmy UTSW 13 93459703 missense probably damaging 1.00
R3522:Jmy UTSW 13 93454050 missense probably damaging 1.00
R3765:Jmy UTSW 13 93464711 missense possibly damaging 0.78
R4231:Jmy UTSW 13 93498925 missense probably benign
R4279:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4279:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4330:Jmy UTSW 13 93498882 missense probably damaging 1.00
R4330:Jmy UTSW 13 93499273 missense probably damaging 1.00
R4845:Jmy UTSW 13 93439738 missense possibly damaging 0.80
R5047:Jmy UTSW 13 93441572 missense possibly damaging 0.65
R5403:Jmy UTSW 13 93441396 missense probably benign 0.08
R5941:Jmy UTSW 13 93498825 missense probably benign
R5953:Jmy UTSW 13 93499116 missense possibly damaging 0.62
R6022:Jmy UTSW 13 93453578 splice site probably null
R6150:Jmy UTSW 13 93441133 missense probably benign 0.10
R6520:Jmy UTSW 13 93454039 missense probably benign 0.10
R7073:Jmy UTSW 13 93441333 missense probably benign 0.01
R7074:Jmy UTSW 13 93453931 missense probably benign 0.15
Z1088:Jmy UTSW 13 93441081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGTTAAATGCACACCATAC -3'
(R):5'- ACACCCAGCTCAGGAATCTG -3'

Sequencing Primer
(F):5'- ACCTGATATAAGTCTCTTGATGCTC -3'
(R):5'- TCTTTTCTGTGGCCTGCTG -3'
Posted On2014-06-23