Incidental Mutation 'R1815:Ccdc112'
ID202681
Institutional Source Beutler Lab
Gene Symbol Ccdc112
Ensembl Gene ENSMUSG00000071855
Gene Namecoiled-coil domain containing 112
Synonyms
MMRRC Submission 039843-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R1815 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location46282151-46311928 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46291106 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 188 (N188K)
Ref Sequence ENSEMBL: ENSMUSP00000072614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072835]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072835
AA Change: N188K

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072614
Gene: ENSMUSG00000071855
AA Change: N188K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
coiled coil region 111 199 N/A INTRINSIC
coiled coil region 300 332 N/A INTRINSIC
low complexity region 345 355 N/A INTRINSIC
coiled coil region 362 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 90.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts4 A G 1: 171,256,336 T492A probably damaging Het
Afg3l2 A T 18: 67,415,573 L529* probably null Het
Ak9 A G 10: 41,337,576 E259G probably damaging Het
Apol11b T A 15: 77,635,572 I103F probably damaging Het
Atp7b T C 8: 22,011,651 M864V possibly damaging Het
Atp8a2 A G 14: 60,086,624 L60P probably damaging Het
Begain T C 12: 109,034,107 Y451C probably damaging Het
Bmpr1b A T 3: 141,880,363 I46N probably benign Het
Bms1 T A 6: 118,383,781 K1242M probably damaging Het
Calcoco1 A G 15: 102,713,923 L254P probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdkal1 A G 13: 29,717,791 V132A possibly damaging Het
Cdo1 A G 18: 46,720,302 C130R probably damaging Het
Cep295nl G T 11: 118,332,648 R457S probably damaging Het
Cntn1 A T 15: 92,250,948 I359F probably benign Het
Csnk1g1 T C 9: 66,032,324 V435A probably damaging Het
Csnka2ip A G 16: 64,478,492 V59A probably benign Het
Ddr2 A T 1: 169,995,601 Y371* probably null Het
Dicer1 T C 12: 104,722,151 E389G probably damaging Het
Diexf A C 1: 193,118,283 S410A probably benign Het
Dnah2 T C 11: 69,475,574 I1901V probably damaging Het
Fanci T A 7: 79,438,308 I903N probably damaging Het
Fastk T C 5: 24,441,531 Q471R probably damaging Het
Flvcr1 A T 1: 191,025,380 N238K probably damaging Het
Gm10229 T C 16: 89,015,449 probably benign Het
Gsdmc3 A T 15: 63,869,116 L61H probably damaging Het
H2-M10.5 T A 17: 36,773,944 C187S probably damaging Het
Hmcn2 T C 2: 31,393,043 I1977T probably damaging Het
Itpr2 T A 6: 146,359,416 I905F probably benign Het
Jmy C T 13: 93,454,077 G506D probably damaging Het
Klf4 G T 4: 55,530,977 R45S probably benign Het
Klhdc7b A G 15: 89,387,597 E894G probably damaging Het
Klra7 T C 6: 130,224,107 I229V probably benign Het
Krt35 T C 11: 100,095,739 T150A probably benign Het
Lct T C 1: 128,300,159 Y1199C probably damaging Het
Lmbrd1 T A 1: 24,685,561 N75K possibly damaging Het
Lss T C 10: 76,552,964 S700P probably damaging Het
Ltbp1 A T 17: 75,252,380 Q288L probably benign Het
Micalcl A G 7: 112,412,902 E653G probably damaging Het
Mphosph10 G T 7: 64,392,170 Q9K probably benign Het
Muc15 T A 2: 110,731,258 L13Q probably damaging Het
Ncf4 A G 15: 78,250,402 D18G probably benign Het
Nipsnap1 A G 11: 4,889,101 Y127C probably damaging Het
Nrbp1 T A 5: 31,245,813 I210N probably damaging Het
Nudt12 G A 17: 59,010,136 P172L probably damaging Het
Olfr1537 T C 9: 39,237,990 I145V probably benign Het
Otud4 T A 8: 79,639,989 Y28* probably null Het
Pdcd2l G A 7: 34,186,401 T286I probably benign Het
Pgbd1 A G 13: 21,423,172 V284A probably damaging Het
Phlpp2 C A 8: 109,940,223 T1128K probably damaging Het
Pik3cb A G 9: 99,093,095 V244A possibly damaging Het
Pld1 A G 3: 28,109,768 I783M probably benign Het
Plk5 T C 10: 80,364,021 V454A probably benign Het
Prkci T C 3: 31,038,495 S309P probably damaging Het
Prx A T 7: 27,516,665 D197V probably damaging Het
Ptpn5 A G 7: 47,078,841 L537P probably benign Het
Rev3l T A 10: 39,822,871 N1121K probably benign Het
Rock2 T A 12: 16,972,726 D1055E probably benign Het
Rrp1b T C 17: 32,056,811 V444A probably benign Het
Rsf1 GGCGGCGGCGGCGGCGGCGGCGGCGGCGGC GGCGGCGGCGGCGGCGGCGGCGGCGGCGGCGGC 7: 97,579,906 probably benign Het
Rsf1 GCG GCGACG 7: 97,579,907 probably benign Het
Rsf1 CG CGACGGGG 7: 97,579,908 probably benign Het
S1pr2 G A 9: 20,968,092 R147* probably null Het
Serpinb9b A T 13: 33,039,904 I360F probably damaging Het
Smc6 T C 12: 11,294,601 probably null Het
Srsf11 C T 3: 158,016,427 probably benign Het
Sstr1 T C 12: 58,213,478 F296L possibly damaging Het
Tecrl T A 5: 83,279,234 I356L probably benign Het
Tln2 A G 9: 67,229,423 I2348T probably damaging Het
Tmed11 T A 5: 108,777,425 I174L probably benign Het
Tmem132a G A 19: 10,861,567 Q504* probably null Het
Unc5c A T 3: 141,757,757 D213V probably damaging Het
Vgll4 T C 6: 114,864,059 D92G probably benign Het
Vps37a T C 8: 40,512,121 F5L probably benign Het
Zdhhc20 A T 14: 57,890,143 V13E probably benign Het
Zeb1 G A 18: 5,767,898 C803Y probably damaging Het
Zmym1 T C 4: 127,049,021 T427A possibly damaging Het
Other mutations in Ccdc112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Ccdc112 APN 18 46293444 missense possibly damaging 0.81
IGL02860:Ccdc112 APN 18 46287442 missense probably benign 0.00
R0546:Ccdc112 UTSW 18 46291072 missense possibly damaging 0.73
R0566:Ccdc112 UTSW 18 46290810 missense probably damaging 0.97
R1847:Ccdc112 UTSW 18 46287754 missense possibly damaging 0.80
R1853:Ccdc112 UTSW 18 46285700 missense probably benign 0.07
R2011:Ccdc112 UTSW 18 46287432 missense probably damaging 1.00
R3787:Ccdc112 UTSW 18 46299298 missense probably benign 0.03
R4519:Ccdc112 UTSW 18 46287546 missense possibly damaging 0.94
R4795:Ccdc112 UTSW 18 46287672 missense probably benign 0.20
R4873:Ccdc112 UTSW 18 46296289 missense probably damaging 1.00
R4875:Ccdc112 UTSW 18 46296289 missense probably damaging 1.00
R7208:Ccdc112 UTSW 18 46287631 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACAAAGTTCTGGTGGTCCAAG -3'
(R):5'- GGAAACAAACTTCCTTTAAGGCTC -3'

Sequencing Primer
(F):5'- AAGTTCTGGTGGTCCAAGGCATC -3'
(R):5'- CAAACTTCCTTTAAGGCTCATACATG -3'
Posted On2014-06-23