ID | 202688 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Institutional Source | Beutler Lab | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Symbol | Arhgap36 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ensembl Gene | ENSMUSG00000036198 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Name | Rho GTPase activating protein 36 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | 1100001E04Rik | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Accession Numbers | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Essential gene? | Probably non essential (E-score: 0.126) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Stock # | Y5409 () | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Quality Score | 225 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Status | Not validated | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosome | X | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Chromosomal Location | 48552822-48589121 bp(+) (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Type of Mutation | missense | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DNA Base Change (assembly) | A to G at 48584310 bp (GRCm39) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Zygosity | Heterozygous | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Amino Acid Change | Asparagine to Aspartic acid at position 159 (N159D) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Ref Sequence | ENSEMBL: ENSMUSP00000110554 (fasta) | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Gene Model | predicted gene model for transcript(s): [ENSMUST00000042444] [ENSMUST00000114904] [ENSMUST00000130558] | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
AlphaFold | B1AUC7 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000042444 AA Change: N159D PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000040798 Gene: ENSMUSG00000036198 AA Change: N159D
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000114904 AA Change: N159D PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000110554 Gene: ENSMUSG00000036198 AA Change: N159D
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
probably benign Transcript: ENSMUST00000130558 AA Change: N143D PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44) |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SMART Domains |
Protein: ENSMUSP00000119757 Gene: ENSMUSG00000036198 AA Change: N143D
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000132784 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Effect |
noncoding transcript Transcript: ENSMUST00000151128 |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Coding Region Coverage |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Validation Efficiency | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Allele List at MGI | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in this stock |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Other mutations in Arhgap36 |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Predicted Primers |
PCR Primer (F):5'- CTCAAGACCTTTGGCATCCG -3' (R):5'- GCCAGACTAGCTTGAAATGAAG -3' Sequencing Primer (F):5'- TCCGCCTGGAAGAGGTACTG -3' (R):5'- ACTCCTAAGTGGTTGCTGAGTGAC -3' |
||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Posted On | 2014-06-23 |