Mutagenetix > Incidental Mutation

Incidental Mutation 'Y5377:Lhb'

202691

Institutional Source

Beutler Lab

Gene Symbol

Lhb

Ensembl Gene

ENSMUSG00000100916

Gene Name

luteinizing hormone beta

Synonyms

LH, leutropin, Gm29035

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.179) question?

Stock #

Y5377 ()

Quality Score

101

Status

Not validated

Chromosome

Chromosomal Location

45070370-45071278 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 45070723 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 34 (A34T)

Ref Sequence

ENSEMBL: ENSMUSP00000072276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058879] [ENSMUST00000072453] [ENSMUST00000107771] [ENSMUST00000210271] [ENSMUST00000210439] [ENSMUST00000211214] [ENSMUST00000211666]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000058879

SMART Domains

Protein: ENSMUSP00000057916
Gene: ENSMUSG00000074121

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	50	74	N/A	INTRINSIC
NGF	88	201	8.06e-83	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000072453
AA Change: A34T

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000072276
Gene: ENSMUSG00000100916
AA Change: A34T

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
GHB	25	131	2.2e-64	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107771

SMART Domains

Protein: ENSMUSP00000103400
Gene: ENSMUSG00000003868

Domain	Start	End	E-Value	Type
AAA	69	361	5.17e-10	SMART
Blast:AAA	373	417	3e-17	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000209426

Predicted Effect

probably benign
Transcript: ENSMUST00000210271

Predicted Effect

probably benign
Transcript: ENSMUST00000210439

Predicted Effect

probably benign
Transcript: ENSMUST00000211214

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211478

Predicted Effect

probably benign
Transcript: ENSMUST00000211440

Predicted Effect

probably benign
Transcript: ENSMUST00000211666

Coding Region Coverage

1x: 97.4%
3x: 96.9%
10x: 95.2%
20x: 92.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the glycoprotein hormone beta chain family and encodes the beta subunit of luteinizing hormone (LH). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. LH is expressed in the pituitary gland and promotes spermatogenesis and ovulation by stimulating the testes and ovaries to synthesize steroids. The genes for the beta chains of chorionic gonadotropin and for luteinizing hormone are contiguous on chromosome 19q13.3. Mutations in this gene are associated with hypogonadism which is characterized by infertility and pseudohermaphroditism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display male and female infertility, hypogonadism, azoospermia, absent corpora lutea, degenerating oocytes, and reduced serum levels of estradiol, progesterone, and testosterone. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 3 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Mmp17	C	T	5: 129,672,594 (GRCm39)	A182V	probably damaging	Het
Nolc1	AGC	AGCGGC	19: 46,069,808 (GRCm39)		probably benign	Het
Pole	G	T	5: 110,442,757 (GRCm39)		probably null	Het

Other mutations in Lhb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02353:Lhb	APN	7	45,070,718 (GRCm39)	missense	possibly damaging	0.64
IGL02360:Lhb	APN	7	45,070,718 (GRCm39)	missense	possibly damaging	0.64
R1872:Lhb	UTSW	7	45,070,757 (GRCm39)	missense	probably damaging	0.96
R4327:Lhb	UTSW	7	45,070,383 (GRCm39)	missense	possibly damaging	0.93
R7564:Lhb	UTSW	7	45,071,101 (GRCm39)	missense	probably damaging	0.99
R8370:Lhb	UTSW	7	45,071,066 (GRCm39)	missense	probably damaging	0.98
Z1088:Lhb	UTSW	7	45,071,154 (GRCm39)	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AACAGATTTCATGGCTGGTGATG -3'
(R):5'- AAGCCCTCTTCTGAGTGTCC -3'

Sequencing Primer
(F):5'- ATGGGTCTTGAAGGACAGTTTC -3'
(R):5'- CGCTCTAGGTGGAATGCC -3'

Posted On

2014-06-23