Incidental Mutation 'R1574:Cdc25b'
ID202704
Institutional Source Beutler Lab
Gene Symbol Cdc25b
Ensembl Gene ENSMUSG00000027330
Gene Namecell division cycle 25B
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1574 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location131186949-131198497 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 131191137 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028801] [ENSMUST00000028804] [ENSMUST00000079857]
Predicted Effect probably benign
Transcript: ENSMUST00000028801
SMART Domains Protein: ENSMUSP00000028801
Gene: ENSMUSG00000027329

DomainStartEndE-ValueType
Pfam:CH_2 13 109 9.3e-36 PFAM
Pfam:CAMSAP_CH 14 96 7.9e-24 PFAM
coiled coil region 182 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000028804
SMART Domains Protein: ENSMUSP00000028804
Gene: ENSMUSG00000027330

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 379 3.3e-103 PFAM
RHOD 417 531 4.29e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079857
SMART Domains Protein: ENSMUSP00000078784
Gene: ENSMUSG00000027330

DomainStartEndE-ValueType
low complexity region 86 105 N/A INTRINSIC
Pfam:M-inducer_phosp 111 354 2.4e-78 PFAM
RHOD 391 505 4.29e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125423
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138669
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145556
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CDC25B is a member of the CDC25 family of phosphatases. CDC25B activates the cyclin dependent kinase CDC2 by removing two phosphate groups and it is required for entry into mitosis. CDC25B shuttles between the nucleus and the cytoplasm due to nuclear localization and nuclear export signals. The protein is nuclear in the M and G1 phases of the cell cycle and moves to the cytoplasm during S and G2. CDC25B has oncogenic properties, although its role in tumor formation has not been determined. Multiple transcript variants for this gene exist. [provided by RefSeq, Jul 2008]
PHENOTYPE: The resumption of meiosis during oocyte maturation is blocked in homozygous mutant female mice, resulting in female infertility. Male mice do not show an overt reproductive phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl3 T A 5: 81,787,449 N1276K probably damaging Het
Als2cl A G 9: 110,884,060 E6G probably damaging Het
Ankrd12 A T 17: 65,986,274 D721E probably benign Het
Anpep A G 7: 79,838,407 probably null Het
Apeh A T 9: 108,092,726 probably null Het
Apob A T 12: 7,990,839 I655L possibly damaging Het
Atp2b1 T A 10: 98,996,948 L437Q probably damaging Het
Cacna2d3 T A 14: 29,351,822 R222S probably damaging Het
Cdon A G 9: 35,452,937 probably benign Het
Cenpf C T 1: 189,652,713 D2457N probably damaging Het
Cenpo A T 12: 4,215,433 probably null Het
Ces2b G T 8: 104,835,889 A284S probably benign Het
Clock T C 5: 76,242,832 D311G probably damaging Het
Csmd3 T C 15: 47,695,861 probably null Het
Dbil5 A G 11: 76,218,482 M71V probably benign Het
Ddhd1 A C 14: 45,595,547 L864R probably damaging Het
Ddx19a T C 8: 110,993,111 probably benign Het
Dnah11 A G 12: 118,060,317 C1900R probably damaging Het
Dnah2 A G 11: 69,514,688 V666A probably benign Het
Dnah5 T A 15: 28,252,423 M754K probably benign Het
Dnajc15 A T 14: 77,826,414 S145T probably benign Het
Drap1 A G 19: 5,424,257 F25S probably damaging Het
Fam83e G A 7: 45,726,711 E283K probably damaging Het
Fbxo48 G T 11: 16,953,368 probably benign Het
Fndc3a A T 14: 72,556,557 I892N probably damaging Het
Gcn1l1 A G 5: 115,615,552 T2321A probably benign Het
Gm1110 G T 9: 26,881,126 probably benign Het
Gm5499 T C 17: 87,078,995 noncoding transcript Het
Gmnc G T 16: 26,963,979 probably benign Het
Greb1l A G 18: 10,554,997 D1681G possibly damaging Het
Hc G A 2: 35,000,765 probably benign Het
Hmcn2 A C 2: 31,404,887 T2563P probably damaging Het
Iqcd A T 5: 120,600,235 K39N probably damaging Het
Kank2 A G 9: 21,774,575 S668P probably damaging Het
Kcng1 T A 2: 168,269,041 N68Y probably damaging Het
Kmt5b T A 19: 3,786,633 probably null Het
Lama2 T A 10: 27,324,754 I533F possibly damaging Het
Lcmt1 T A 7: 123,402,908 I132N probably damaging Het
Lrmp T G 6: 145,158,630 probably benign Het
Mad2l2 G T 4: 148,142,972 probably benign Het
Mcph1 T C 8: 18,801,412 I807T probably damaging Het
Mdn1 A G 4: 32,722,315 I2366V probably benign Het
Moxd1 T C 10: 24,300,319 W558R probably damaging Het
Myh13 T C 11: 67,362,581 probably benign Het
Myrf T C 19: 10,225,487 D141G probably damaging Het
Ncoa7 T C 10: 30,694,101 I249M probably damaging Het
Obox5 T C 7: 15,758,633 V171A probably damaging Het
Olfr1352 C A 10: 78,983,986 N32K probably damaging Het
Olfr15 T C 16: 3,839,657 I228T probably damaging Het
Olfr70 A T 4: 43,697,134 V13D possibly damaging Het
Olfr818 A G 10: 129,945,510 L69P probably damaging Het
Olfr988 A T 2: 85,353,899 V9E probably damaging Het
Parp4 A G 14: 56,602,295 T487A probably damaging Het
Pclo A G 5: 14,679,831 probably benign Het
Pcnx2 G A 8: 125,773,930 R1474C probably damaging Het
Prrxl1 A G 14: 32,605,324 probably benign Het
Qtrt2 A G 16: 43,871,832 probably benign Het
Sart1 G A 19: 5,380,259 P788L probably damaging Het
Sdk1 A G 5: 141,998,879 T740A probably benign Het
Serpinb1c T C 13: 32,888,996 D61G possibly damaging Het
Slc24a5 G A 2: 125,080,862 G152S probably damaging Het
Slc6a4 A T 11: 77,019,196 I426F possibly damaging Het
Stk33 C T 7: 109,279,820 V441I probably benign Het
Sult1c2 A G 17: 53,836,899 probably null Het
Tdpoz4 T A 3: 93,796,528 V44E probably benign Het
Tmprss13 C A 9: 45,343,231 T432K probably damaging Het
Traf7 A G 17: 24,510,553 L428P probably damaging Het
Tubb1 T C 2: 174,457,422 I299T probably benign Het
Vmn1r158 A T 7: 22,790,347 W146R probably damaging Het
Vmn1r42 A G 6: 89,845,077 I170T possibly damaging Het
Vmn2r116 A T 17: 23,387,089 H325L probably damaging Het
Zfp516 T A 18: 82,993,175 L1111H possibly damaging Het
Zfp61 C G 7: 24,291,210 K505N probably damaging Het
Zfp653 C A 9: 22,057,978 E331* probably null Het
Zfp949 A T 9: 88,569,777 K467* probably null Het
Other mutations in Cdc25b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Cdc25b APN 2 131188140 missense probably benign 0.00
R0471:Cdc25b UTSW 2 131197284 missense probably damaging 0.99
R0639:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R0645:Cdc25b UTSW 2 131191613 missense probably benign 0.06
R0673:Cdc25b UTSW 2 131197262 missense probably benign 0.00
R4094:Cdc25b UTSW 2 131189117 missense probably benign
R4433:Cdc25b UTSW 2 131191698 missense probably benign 0.02
R4722:Cdc25b UTSW 2 131193351 missense probably damaging 1.00
R4817:Cdc25b UTSW 2 131193303 missense probably damaging 1.00
R4957:Cdc25b UTSW 2 131193605 missense possibly damaging 0.80
R5345:Cdc25b UTSW 2 131192596 missense probably benign 0.18
R5407:Cdc25b UTSW 2 131193647 missense probably damaging 1.00
R5562:Cdc25b UTSW 2 131194758 missense probably damaging 1.00
R5594:Cdc25b UTSW 2 131191618 missense probably damaging 1.00
R5792:Cdc25b UTSW 2 131191759 missense probably damaging 1.00
R5831:Cdc25b UTSW 2 131187381 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTTTCATTCAAGGCAGTC -3'
(R):5'- TTCAGAGCTATGGAACCGGG -3'

Sequencing Primer
(F):5'- GCAGTCCTTAAAATCCCAGGCTG -3'
(R):5'- ATCTGCATCGCATGAGAC -3'
Posted On2014-06-23