Incidental Mutation 'R1786:Cad'
ID202801
Institutional Source Beutler Lab
Gene Symbol Cad
Ensembl Gene ENSMUSG00000013629
Gene Namecarbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase
Synonyms
MMRRC Submission 039817-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R1786 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31054780-31078479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31058072 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 76 (F76I)
Ref Sequence ENSEMBL: ENSMUSP00000144127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013766] [ENSMUST00000013773] [ENSMUST00000200942] [ENSMUST00000200953] [ENSMUST00000201136] [ENSMUST00000201182] [ENSMUST00000201773] [ENSMUST00000201838] [ENSMUST00000202795]
Predicted Effect probably benign
Transcript: ENSMUST00000013766
SMART Domains Protein: ENSMUSP00000013766
Gene: ENSMUSG00000013622

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 149 187 2.03e1 SMART
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000013773
AA Change: F76I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000013773
Gene: ENSMUSG00000013629
AA Change: F76I

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.7e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.2e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.8e-85 PFAM
Pfam:ATP-grasp 522 690 1.5e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.2e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.8e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.4e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1924 2065 1.9e-44 PFAM
Pfam:OTCace 2071 2221 7.6e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000031049
AA Change: F76I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031049
Gene: ENSMUSG00000013629
AA Change: F76I

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 3.8e-48 PFAM
Pfam:CPSase_L_chain 392 509 2.1e-20 PFAM
Pfam:CPSase_L_D2 514 616 1.9e-34 PFAM
Pfam:ATP-grasp 522 626 1.7e-6 PFAM
Pfam:Dala_Dala_lig_C 524 624 2.7e-7 PFAM
Pfam:CPSase_L_D2 614 655 5.2e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:CPSase_L_chain 868 979 2.9e-20 PFAM
Pfam:ATP-grasp_4 981 1160 6.4e-24 PFAM
Pfam:CPSase_L_D2 984 1187 3.5e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 1.2e-6 PFAM
Pfam:ATP-grasp 992 1159 1.6e-11 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_5 1374 1437 9.4e-7 PFAM
Pfam:Amidohydro_1 1399 1597 1.9e-12 PFAM
Pfam:Amidohydro_4 1401 1692 5.5e-15 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2003 1.7e-48 PFAM
Pfam:OTCace 2008 2158 1.5e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200800
Predicted Effect probably benign
Transcript: ENSMUST00000200942
Predicted Effect possibly damaging
Transcript: ENSMUST00000200953
AA Change: F76I

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144307
Gene: ENSMUSG00000013629
AA Change: F76I

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:CPSase_L_D2 514 616 1.5e-34 PFAM
Pfam:Dala_Dala_lig_C 527 625 2.4e-7 PFAM
Pfam:CPSase_L_D2 614 655 4.9e-15 PFAM
CPSase_L_D3 735 858 9.7e-59 SMART
Pfam:ATP-grasp_4 981 1160 1.7e-23 PFAM
Pfam:CPSase_L_D2 984 1187 3e-28 PFAM
Pfam:Dala_Dala_lig_C 991 1179 2.3e-7 PFAM
Pfam:ATP-grasp 992 1159 2.1e-12 PFAM
MGS 1264 1365 1.35e-7 SMART
Pfam:Amidohydro_1 1399 1667 7.1e-12 PFAM
low complexity region 1757 1776 N/A INTRINSIC
low complexity region 1801 1817 N/A INTRINSIC
Pfam:OTCace_N 1861 2002 1.8e-44 PFAM
Pfam:OTCace 2008 2158 7.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201136
SMART Domains Protein: ENSMUSP00000144085
Gene: ENSMUSG00000013622

DomainStartEndE-ValueType
EGF 96 134 2.03e1 SMART
transmembrane domain 138 160 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201182
AA Change: F76I

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000144684
Gene: ENSMUSG00000013629
AA Change: F76I

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 4.5e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.1e-15 PFAM
Pfam:CPSase_L_D2 514 718 1.7e-85 PFAM
Pfam:ATP-grasp 522 690 1.4e-9 PFAM
Pfam:Dala_Dala_lig_C 527 687 2.1e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 1.7e-23 PFAM
Pfam:CPSase_L_D2 1047 1250 3e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 2.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 2.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 7.1e-12 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1949 1994 1.4e-11 PFAM
Pfam:OTCace 2000 2150 7.3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201773
SMART Domains Protein: ENSMUSP00000144333
Gene: ENSMUSG00000013622

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000201838
AA Change: F76I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144127
Gene: ENSMUSG00000013629
AA Change: F76I

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 6.3e-48 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 1.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 3.7e-86 PFAM
Pfam:ATP-grasp 522 690 2.5e-10 PFAM
Pfam:Dala_Dala_lig_C 526 687 4.2e-11 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
SCOP:d1a9xa3 935 964 1e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201844
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201887
Predicted Effect possibly damaging
Transcript: ENSMUST00000202795
AA Change: F76I

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000144009
Gene: ENSMUSG00000013629
AA Change: F76I

DomainStartEndE-ValueType
CPSase_sm_chain 1 139 8.81e-80 SMART
Pfam:GATase 179 356 1.9e-47 PFAM
low complexity region 397 407 N/A INTRINSIC
Pfam:ATP-grasp_4 511 692 5.9e-16 PFAM
Pfam:CPSase_L_D2 514 718 1.2e-85 PFAM
Pfam:ATP-grasp 522 690 7.3e-10 PFAM
Pfam:Dala_Dala_lig_C 527 687 1.3e-10 PFAM
CPSase_L_D3 798 921 9.7e-59 SMART
Pfam:ATP-grasp_4 1044 1223 8.9e-24 PFAM
Pfam:CPSase_L_D2 1047 1250 2.1e-28 PFAM
Pfam:Dala_Dala_lig_C 1054 1242 1.3e-7 PFAM
Pfam:ATP-grasp 1055 1222 1.1e-12 PFAM
MGS 1327 1428 1.35e-7 SMART
Pfam:Amidohydro_1 1462 1730 2.5e-11 PFAM
low complexity region 1820 1839 N/A INTRINSIC
low complexity region 1864 1880 N/A INTRINSIC
Pfam:OTCace_N 1970 2004 4.6e-11 PFAM
Pfam:OTCace 2010 2160 9.9e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202967
Meta Mutation Damage Score 0.184 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The de novo synthesis of pyrimidine nucleotides is required for mammalian cells to proliferate. This gene encodes a trifunctional protein which is associated with the enzymatic activities of the first 3 enzymes in the 6-step pathway of pyrimidine biosynthesis: carbamoylphosphate synthetase (CPS II), aspartate transcarbamoylase, and dihydroorotase. This protein is regulated by the mitogen-activated protein kinase (MAPK) cascade, which indicates a direct link between activation of the MAPK cascade and de novo biosynthesis of pyrimidine nucleotides. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Cad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Cad APN 5 31061484 missense probably damaging 1.00
IGL00908:Cad APN 5 31059054 missense possibly damaging 0.93
IGL01068:Cad APN 5 31061770 splice site probably benign
IGL01638:Cad APN 5 31067614 missense probably damaging 1.00
IGL02483:Cad APN 5 31060826 critical splice acceptor site probably null
IGL02499:Cad APN 5 31069604 missense probably damaging 1.00
IGL02691:Cad APN 5 31055294 missense probably damaging 1.00
IGL03002:Cad APN 5 31054986 missense probably benign 0.00
R0212:Cad UTSW 5 31078110 missense probably damaging 1.00
R0317:Cad UTSW 5 31072321 missense probably benign 0.01
R0335:Cad UTSW 5 31073985 unclassified probably benign
R0401:Cad UTSW 5 31073986 unclassified probably benign
R0445:Cad UTSW 5 31072709 missense probably benign 0.08
R0494:Cad UTSW 5 31077512 unclassified probably benign
R0532:Cad UTSW 5 31062187 splice site probably benign
R0539:Cad UTSW 5 31075457 splice site probably benign
R0578:Cad UTSW 5 31058776 missense probably benign 0.01
R0590:Cad UTSW 5 31062231 missense probably damaging 1.00
R0638:Cad UTSW 5 31077688 missense probably damaging 0.98
R0831:Cad UTSW 5 31067600 missense probably damaging 1.00
R1329:Cad UTSW 5 31059582 missense probably damaging 1.00
R1513:Cad UTSW 5 31068762 missense probably damaging 1.00
R1531:Cad UTSW 5 31076219 missense probably benign 0.14
R1763:Cad UTSW 5 31060951 missense probably damaging 1.00
R1785:Cad UTSW 5 31058072 missense probably damaging 1.00
R2131:Cad UTSW 5 31058072 missense probably damaging 1.00
R2165:Cad UTSW 5 31062220 missense probably damaging 1.00
R3103:Cad UTSW 5 31061674 missense possibly damaging 0.95
R3113:Cad UTSW 5 31074137 missense possibly damaging 0.50
R3762:Cad UTSW 5 31075546 intron probably null
R3847:Cad UTSW 5 31061650 missense probably damaging 1.00
R3898:Cad UTSW 5 31074022 missense probably benign 0.06
R3943:Cad UTSW 5 31072385 critical splice donor site probably null
R4213:Cad UTSW 5 31072344 missense probably benign 0.01
R4458:Cad UTSW 5 31061226 missense probably damaging 1.00
R4562:Cad UTSW 5 31058133 missense possibly damaging 0.82
R4629:Cad UTSW 5 31070295 missense probably damaging 1.00
R4717:Cad UTSW 5 31066686 critical splice acceptor site probably null
R4811:Cad UTSW 5 31074690 missense probably benign 0.02
R5044:Cad UTSW 5 31055021 missense probably benign 0.00
R5630:Cad UTSW 5 31060573 missense probably damaging 1.00
R5660:Cad UTSW 5 31076847 missense probably damaging 1.00
R6008:Cad UTSW 5 31069112 missense probably damaging 1.00
R6029:Cad UTSW 5 31054983 missense possibly damaging 0.65
R6073:Cad UTSW 5 31062562 missense possibly damaging 0.84
R6240:Cad UTSW 5 31072978 missense probably benign 0.00
R6260:Cad UTSW 5 31066800 missense probably null
X0021:Cad UTSW 5 31068131 missense probably null 1.00
X0022:Cad UTSW 5 31072317 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGTTCTCTGGACACGATAGGC -3'
(R):5'- GAAACCTCCCTGATTCTCTCGG -3'

Sequencing Primer
(F):5'- ACACGATAGGCCCATGTTCAGTG -3'
(R):5'- GTCTAGGTACTGTGTACTTTACCCAG -3'
Posted On2014-06-23