Incidental Mutation 'R1786:Cars'
ID202816
Institutional Source Beutler Lab
Gene Symbol Cars
Ensembl Gene ENSMUSG00000010755
Gene Namecysteinyl-tRNA synthetase
SynonymsCA3
MMRRC Submission 039817-MU
Accession Numbers

Genbank: NM_013742

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1786 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location143557230-143600090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 143592474 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Methionine at position 71 (R71M)
Ref Sequence ENSEMBL: ENSMUSP00000010899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010899] [ENSMUST00000105909] [ENSMUST00000154022]
Predicted Effect probably damaging
Transcript: ENSMUST00000010899
AA Change: R71M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000010899
Gene: ENSMUSG00000010755
AA Change: R71M

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 124 537 2.7e-128 PFAM
Blast:DALR_2 584 644 2e-13 BLAST
coiled coil region 728 768 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105909
SMART Domains Protein: ENSMUSP00000101529
Gene: ENSMUSG00000010755

DomainStartEndE-ValueType
Pfam:tRNA-synt_1e 41 454 2e-129 PFAM
Pfam:tRNA-synt_1g 387 465 1.2e-6 PFAM
Blast:DALR_2 501 561 1e-13 BLAST
coiled coil region 645 685 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151574
Predicted Effect probably benign
Transcript: ENSMUST00000154022
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a class 1 aminoacyl-tRNA synthetase, cysteinyl-tRNA synthetase. Each of the twenty aminoacyl-tRNA synthetases catalyzes the aminoacylation of a specific tRNA or tRNA isoaccepting family with the cognate amino acid. This gene is one of several located near the imprinted gene domain on chromosome 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian and breast cancers. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Allele List at MGI

All alleles(37) : Targeted, other(2) Gene trapped(35)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Cars
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Cars APN 7 143569849 missense probably benign 0.03
IGL02192:Cars APN 7 143571588 missense probably damaging 1.00
IGL02645:Cars APN 7 143557909 missense probably damaging 0.97
IGL02807:Cars APN 7 143569472 missense possibly damaging 0.87
IGL02860:Cars APN 7 143586421 missense probably damaging 1.00
IGL03005:Cars APN 7 143559169 missense probably damaging 1.00
vroom UTSW 7 143570648 missense probably damaging 1.00
F5493:Cars UTSW 7 143569871 missense probably damaging 1.00
R0358:Cars UTSW 7 143588482 splice site probably benign
R0452:Cars UTSW 7 143592625 nonsense probably null
R0717:Cars UTSW 7 143584755 missense probably damaging 0.98
R0930:Cars UTSW 7 143570570 missense probably damaging 1.00
R1069:Cars UTSW 7 143570107 missense probably benign 0.40
R1184:Cars UTSW 7 143587139 missense probably damaging 1.00
R1503:Cars UTSW 7 143568989 missense probably benign 0.04
R1755:Cars UTSW 7 143569457 missense probably damaging 1.00
R1762:Cars UTSW 7 143592474 missense probably damaging 1.00
R1783:Cars UTSW 7 143592474 missense probably damaging 1.00
R1828:Cars UTSW 7 143576648 missense probably damaging 0.97
R2084:Cars UTSW 7 143587182 missense probably benign 0.03
R2132:Cars UTSW 7 143592474 missense probably damaging 1.00
R2133:Cars UTSW 7 143592474 missense probably damaging 1.00
R2397:Cars UTSW 7 143592507 missense possibly damaging 0.61
R4012:Cars UTSW 7 143559674 missense possibly damaging 0.65
R4057:Cars UTSW 7 143570648 missense probably damaging 1.00
R4082:Cars UTSW 7 143569497 missense probably damaging 1.00
R4118:Cars UTSW 7 143559647 critical splice donor site probably null
R4527:Cars UTSW 7 143565049 missense probably benign 0.22
R4663:Cars UTSW 7 143575960 missense probably damaging 1.00
R4758:Cars UTSW 7 143571567 missense probably benign 0.01
R4820:Cars UTSW 7 143570564 missense probably damaging 1.00
R4921:Cars UTSW 7 143569475 missense probably damaging 1.00
R4923:Cars UTSW 7 143569850 missense probably damaging 0.97
R5512:Cars UTSW 7 143570133 missense possibly damaging 0.91
R6505:Cars UTSW 7 143565007 missense probably damaging 1.00
X0021:Cars UTSW 7 143576584 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CGCTGAGCTACATGTTGGTTAC -3'
(R):5'- TTCTGAGCATTAGTGACGAGG -3'

Sequencing Primer
(F):5'- GGTTACATGACTTTATCCTACCAGAC -3'
(R):5'- CATTAGTGACGAGGCAGCC -3'
Posted On2014-06-23