Incidental Mutation 'R1786:Olfr372'
ID202818
Institutional Source Beutler Lab
Gene Symbol Olfr372
Ensembl Gene ENSMUSG00000069998
Gene Nameolfactory receptor 372
SynonymsGA_x6K02T2NUPS-191522-192466, MOR282-1
MMRRC Submission 039817-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R1786 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72041218-72060630 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72058436 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 252 (Y252C)
Ref Sequence ENSEMBL: ENSMUSP00000149288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093434] [ENSMUST00000215324]
Predicted Effect probably damaging
Transcript: ENSMUST00000093434
AA Change: Y252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132724
Gene: ENSMUSG00000069998
AA Change: Y252C

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2e-57 PFAM
Pfam:7TM_GPCR_Srsx 35 221 1.1e-7 PFAM
Pfam:7tm_1 41 290 6.4e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215324
AA Change: Y252C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.502 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Olfr372
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03251:Olfr372 APN 8 72058076 missense probably damaging 1.00
R0126:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0128:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0130:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0131:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0132:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0152:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0230:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0244:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0256:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0257:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0294:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0316:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0318:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0391:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0479:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0604:Olfr372 UTSW 8 72058400 missense probably damaging 1.00
R0624:Olfr372 UTSW 8 72058162 missense possibly damaging 0.94
R0631:Olfr372 UTSW 8 72058322 missense probably damaging 0.99
R1785:Olfr372 UTSW 8 72058436 missense probably damaging 1.00
R2040:Olfr372 UTSW 8 72057763 missense possibly damaging 0.77
R4176:Olfr372 UTSW 8 72058184 missense probably damaging 1.00
R4782:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R4799:Olfr372 UTSW 8 72058094 missense probably benign 0.00
R6915:Olfr372 UTSW 8 72057730 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TCTCCTCAAGCTGTCATGTG -3'
(R):5'- GACATCATCGCTTCACCCTG -3'

Sequencing Primer
(F):5'- TCAAGCTGTCATGTGCAGAC -3'
(R):5'- TCGCTTCACCCTGAAATCAG -3'
Posted On2014-06-23