Incidental Mutation 'R1786:Camk2b'
ID202833
Institutional Source Beutler Lab
Gene Symbol Camk2b
Ensembl Gene ENSMUSG00000057897
Gene Namecalcium/calmodulin-dependent protein kinase II, beta
SynonymsCaMK II
MMRRC Submission 039817-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R1786 (G1)
Quality Score122
Status Validated
Chromosome11
Chromosomal Location5969644-6066362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5977880 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 390 (E390G)
Ref Sequence ENSEMBL: ENSMUSP00000091046 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002817] [ENSMUST00000019133] [ENSMUST00000066431] [ENSMUST00000090443] [ENSMUST00000093355] [ENSMUST00000101585] [ENSMUST00000101586] [ENSMUST00000109812] [ENSMUST00000109813] [ENSMUST00000109815]
Predicted Effect probably benign
Transcript: ENSMUST00000002817
SMART Domains Protein: ENSMUSP00000002817
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 371 498 5.3e-63 PFAM
Pfam:DUF4440 375 489 2.8e-15 PFAM
Pfam:SnoaL_3 375 500 2.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019133
AA Change: E467G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000019133
Gene: ENSMUSG00000057897
AA Change: E467G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
low complexity region 436 451 N/A INTRINSIC
low complexity region 468 491 N/A INTRINSIC
low complexity region 511 533 N/A INTRINSIC
Pfam:CaMKII_AD 534 661 3.7e-62 PFAM
Pfam:DUF4440 538 652 1.6e-13 PFAM
Pfam:SnoaL_3 538 663 4.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000066431
SMART Domains Protein: ENSMUSP00000065101
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 347 474 4.8e-63 PFAM
Pfam:DUF4440 351 465 2.6e-15 PFAM
Pfam:SnoaL_3 351 476 2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090443
SMART Domains Protein: ENSMUSP00000087925
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 390 412 N/A INTRINSIC
Pfam:CaMKII_AD 413 540 6.1e-63 PFAM
Pfam:DUF4440 417 531 3.2e-15 PFAM
Pfam:SnoaL_3 417 542 2.5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093355
AA Change: E390G

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000091046
Gene: ENSMUSG00000057897
AA Change: E390G

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
internal_repeat_1 373 388 8.07e-7 PROSPERO
low complexity region 391 414 N/A INTRINSIC
internal_repeat_1 416 431 8.07e-7 PROSPERO
low complexity region 434 456 N/A INTRINSIC
Pfam:CaMKII_AD 457 584 5.8e-63 PFAM
Pfam:DUF4440 461 575 6.7e-15 PFAM
Pfam:SnoaL_3 461 586 4.8e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101585
SMART Domains Protein: ENSMUSP00000099119
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101586
SMART Domains Protein: ENSMUSP00000099120
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
Pfam:CaMKII_AD 386 513 5.6e-63 PFAM
Pfam:DUF4440 390 504 3e-15 PFAM
Pfam:SnoaL_3 390 515 2.3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109812
SMART Domains Protein: ENSMUSP00000105437
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 283 5.98e-95 SMART
Pfam:CaMKII_AD 397 524 5.8e-63 PFAM
Pfam:DUF4440 401 515 3.1e-15 PFAM
Pfam:SnoaL_3 401 526 2.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109813
SMART Domains Protein: ENSMUSP00000105438
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109815
SMART Domains Protein: ENSMUSP00000105440
Gene: ENSMUSG00000057897

DomainStartEndE-ValueType
S_TKc 14 272 1.37e-103 SMART
low complexity region 320 336 N/A INTRINSIC
Pfam:CaMKII_AD 410 537 1.4e-62 PFAM
Pfam:DUF4440 414 528 5.9e-15 PFAM
Pfam:SnoaL_3 414 539 5e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155755
Meta Mutation Damage Score 0.168 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the serine/threonine protein kinase family and to the Ca(2+)/calmodulin-dependent protein kinase subfamily. Calcium signaling is crucial for several aspects of plasticity at glutamatergic synapses. In mammalian cells, the enzyme is composed of four different chains: alpha, beta, gamma, and delta. The product of this gene is a beta chain. It is possible that distinct isoforms of this chain have different cellular localizations and interact differently with calmodulin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit reversal of plasticity direction at parallel fiber-Purkinje cell synapses. Mice homozygous for a different null allele show motor impairments, including ataxia, altered body mass composition, a reduction in anxiety-related behavior, and cognitive deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Vps13b A G 15: 35,879,791 Y3004C probably damaging Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Camk2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Camk2b APN 11 5972310 missense probably damaging 1.00
IGL01821:Camk2b APN 11 5997890 missense possibly damaging 0.92
IGL02219:Camk2b APN 11 5976872 missense possibly damaging 0.56
IGL02890:Camk2b APN 11 6001340 missense possibly damaging 0.90
R1645:Camk2b UTSW 11 5972719 missense probably damaging 1.00
R1836:Camk2b UTSW 11 5972384 missense probably damaging 1.00
R2133:Camk2b UTSW 11 5977880 missense probably benign 0.06
R3828:Camk2b UTSW 11 6028932 missense probably damaging 0.99
R4283:Camk2b UTSW 11 5987099 missense probably benign 0.39
R5919:Camk2b UTSW 11 5979718 missense probably damaging 1.00
R6074:Camk2b UTSW 11 5989635 missense probably damaging 1.00
R6269:Camk2b UTSW 11 5978497 missense probably damaging 1.00
R6595:Camk2b UTSW 11 5992856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCCAGCTATGTTAGTGC -3'
(R):5'- CAGATTCCCTTGTGGTAAGAGC -3'

Sequencing Primer
(F):5'- GCCCAGCTATGTTAGTGCATATGC -3'
(R):5'- CCCTTGTGGTAAGAGCAGGGG -3'
Posted On2014-06-23