Incidental Mutation 'R1786:Vps13b'
ID202858
Institutional Source Beutler Lab
Gene Symbol Vps13b
Ensembl Gene ENSMUSG00000037646
Gene Namevacuolar protein sorting 13B
Synonyms2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik
MMRRC Submission 039817-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.541) question?
Stock #R1786 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location35371160-35931229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35879791 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 3004 (Y3004C)
Ref Sequence ENSEMBL: ENSMUSP00000045490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048646]
Predicted Effect probably damaging
Transcript: ENSMUST00000048646
AA Change: Y3004C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: Y3004C

DomainStartEndE-ValueType
Pfam:Chorein_N 2 120 1e-29 PFAM
low complexity region 128 137 N/A INTRINSIC
low complexity region 143 160 N/A INTRINSIC
low complexity region 975 984 N/A INTRINSIC
low complexity region 1007 1018 N/A INTRINSIC
low complexity region 1876 1883 N/A INTRINSIC
low complexity region 2042 2054 N/A INTRINSIC
low complexity region 2414 2423 N/A INTRINSIC
Pfam:SHR-BD 2601 2700 8.4e-10 PFAM
low complexity region 2954 2964 N/A INTRINSIC
Pfam:VPS13_C 3539 3706 2.6e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228738
Meta Mutation Damage Score 0.128 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (98/101)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik T A 13: 63,210,149 C656S probably benign Het
9030624J02Rik T C 7: 118,794,575 Y516H probably damaging Het
A2ml1 T A 6: 128,576,260 N178I probably damaging Het
Abcc4 G A 14: 118,553,349 R749C probably damaging Het
Acot11 T C 4: 106,762,035 E201G probably damaging Het
Akap13 G T 7: 75,611,434 A1269S probably benign Het
Aldh4a1 T C 4: 139,644,128 V451A probably benign Het
Aox3 A G 1: 58,169,843 H845R probably damaging Het
Asb6 G A 2: 30,827,076 R46W probably damaging Het
Bpifb6 T C 2: 153,906,861 F259S probably damaging Het
Cad T A 5: 31,058,072 F76I probably damaging Het
Camk2b T C 11: 5,977,880 E390G probably benign Het
Cars C A 7: 143,592,474 R71M probably damaging Het
Ccdc170 T G 10: 4,519,043 I197S probably benign Het
Cdc20b A T 13: 113,081,134 K362N probably damaging Het
Cntrl CAGAG CAG 2: 35,122,806 probably null Het
Cpd T C 11: 76,792,798 D1045G probably benign Het
Crocc T C 4: 141,021,802 D1564G probably damaging Het
Csf1r A T 18: 61,129,077 M802L probably damaging Het
Dctn4 T C 18: 60,546,335 probably null Het
Dnah5 A G 15: 28,313,786 Q1916R probably damaging Het
Dpysl2 A G 14: 66,862,665 probably benign Het
Dync2h1 A G 9: 7,081,084 Y2871H probably damaging Het
Fam221b T A 4: 43,665,537 H307L probably damaging Het
Foxn4 C T 5: 114,263,132 D37N probably damaging Het
Gemin4 G C 11: 76,211,050 P962A probably damaging Het
Gm9797 T C 10: 11,609,325 noncoding transcript Het
Golim4 A T 3: 75,908,149 V116D probably damaging Het
Gper1 C T 5: 139,426,722 P274L probably damaging Het
Gpr132 A G 12: 112,852,403 S268P probably damaging Het
Gtpbp2 T C 17: 46,161,202 M21T probably benign Het
Hivep1 C T 13: 42,183,786 A2447V possibly damaging Het
Ift20 G A 11: 78,540,034 E68K probably damaging Het
Insrr G A 3: 87,810,572 probably null Het
Kcnh8 T C 17: 52,893,933 V465A probably damaging Het
Kif5c T A 2: 49,758,805 probably benign Het
Kmt2a G A 9: 44,819,675 probably benign Het
Lhx6 G T 2: 36,087,458 C327* probably null Het
Lifr A G 15: 7,181,856 D625G possibly damaging Het
Llgl1 T C 11: 60,707,240 V370A probably benign Het
Lman1 A T 18: 65,991,582 M362K probably damaging Het
Lmtk2 C T 5: 144,174,988 T842I possibly damaging Het
Lpin3 T A 2: 160,896,809 L227* probably null Het
Ltv1 C G 10: 13,182,536 probably benign Het
Magel2 A T 7: 62,377,738 H130L unknown Het
Mettl17 A T 14: 51,888,735 probably benign Het
Mnx1 T A 5: 29,474,189 S299C unknown Het
Mov10 A T 3: 104,818,116 I59N possibly damaging Het
Myo7b T C 18: 31,994,897 I581V probably benign Het
Ncdn T A 4: 126,745,273 probably null Het
Ndufa4 A T 6: 11,900,575 V37E probably benign Het
Nhsl1 T G 10: 18,524,664 L546R probably benign Het
Nop9 T C 14: 55,751,142 L347P probably damaging Het
Nrp1 A T 8: 128,498,516 E782D probably damaging Het
Ntrk3 G A 7: 78,477,935 probably benign Het
Olfr341 A G 2: 36,480,047 S28P possibly damaging Het
Olfr372 A G 8: 72,058,436 Y252C probably damaging Het
Olfr968 A T 9: 39,772,495 C102S probably benign Het
Osbpl6 T A 2: 76,586,214 I546K probably damaging Het
Pard6g T C 18: 80,117,308 V212A probably damaging Het
Pknox2 A G 9: 36,909,684 V294A probably damaging Het
Plekha1 T C 7: 130,892,253 V106A probably benign Het
Plekha6 C A 1: 133,279,365 probably null Het
Ptgdr A T 14: 44,858,579 Y225* probably null Het
Ptpn22 A G 3: 103,874,052 I90V probably damaging Het
Pygb C T 2: 150,816,772 T372I probably damaging Het
Pzp T C 6: 128,491,161 probably null Het
Qrich2 C T 11: 116,441,449 G2307D probably damaging Het
Rfwd3 A T 8: 111,297,402 V96E probably benign Het
Senp1 T A 15: 98,075,967 T132S probably benign Het
Slc9a4 T G 1: 40,607,741 probably null Het
Slfn9 T A 11: 82,981,307 I868F probably damaging Het
St3gal6 T C 16: 58,475,871 D137G probably damaging Het
Synj1 G T 16: 90,964,517 A687D probably damaging Het
Syt4 A G 18: 31,443,443 probably benign Het
Tacc1 A T 8: 25,164,493 N271K probably damaging Het
Tdrd6 T C 17: 43,624,833 T1775A probably benign Het
Tecpr1 T A 5: 144,208,645 T595S probably benign Het
Tjp3 T A 10: 81,278,054 M457L possibly damaging Het
Tmem200a T A 10: 25,993,927 H148L probably damaging Het
Trappc8 A G 18: 20,834,940 probably null Het
Txk T A 5: 72,696,579 T472S probably damaging Het
Ubr4 T A 4: 139,423,945 M1897K probably damaging Het
Uggt2 A G 14: 119,061,376 L391P probably damaging Het
Uncx T C 5: 139,547,547 S456P probably benign Het
Wisp1 G A 15: 66,906,489 C53Y probably damaging Het
Zbtb46 C T 2: 181,391,431 C479Y probably damaging Het
Zc3h7a A T 16: 11,150,605 Y503* probably null Het
Zdhhc13 T A 7: 48,824,644 L548Q possibly damaging Het
Zfp236 T C 18: 82,621,304 M1225V probably benign Het
Zfp280d T C 9: 72,308,005 F133L probably damaging Het
Zfp503 A T 14: 21,985,520 C443S possibly damaging Het
Zfyve26 T A 12: 79,268,434 I1423F possibly damaging Het
Other mutations in Vps13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Vps13b APN 15 35926226 missense possibly damaging 0.52
IGL00513:Vps13b APN 15 35793884 missense probably damaging 1.00
IGL00516:Vps13b APN 15 35640557 missense probably damaging 1.00
IGL00640:Vps13b APN 15 35417577 missense probably benign
IGL00753:Vps13b APN 15 35372031 missense probably damaging 0.99
IGL00784:Vps13b APN 15 35846900 missense probably damaging 1.00
IGL01138:Vps13b APN 15 35446770 splice site probably benign
IGL01349:Vps13b APN 15 35793945 missense probably benign 0.00
IGL01403:Vps13b APN 15 35709479 missense probably benign 0.00
IGL01535:Vps13b APN 15 35454957 missense possibly damaging 0.67
IGL01571:Vps13b APN 15 35877489 splice site probably benign
IGL01642:Vps13b APN 15 35792072 missense probably benign 0.43
IGL01658:Vps13b APN 15 35671333 missense probably damaging 0.99
IGL01759:Vps13b APN 15 35878789 missense probably damaging 1.00
IGL01763:Vps13b APN 15 35709799 missense possibly damaging 0.72
IGL01906:Vps13b APN 15 35639847 splice site probably benign
IGL01982:Vps13b APN 15 35438904 nonsense probably null
IGL01997:Vps13b APN 15 35709224 missense probably damaging 1.00
IGL02041:Vps13b APN 15 35423245 missense probably damaging 0.98
IGL02073:Vps13b APN 15 35875586 missense possibly damaging 0.52
IGL02077:Vps13b APN 15 35910613 missense possibly damaging 0.68
IGL02141:Vps13b APN 15 35572081 missense probably benign 0.09
IGL02146:Vps13b APN 15 35646333 missense probably benign 0.36
IGL02197:Vps13b APN 15 35930056 missense probably benign 0.02
IGL02311:Vps13b APN 15 35709514 missense probably benign 0.08
IGL02466:Vps13b APN 15 35770741 missense possibly damaging 0.86
IGL02506:Vps13b APN 15 35917162 missense probably damaging 1.00
IGL02550:Vps13b APN 15 35572096 missense probably benign
IGL02553:Vps13b APN 15 35646301 missense probably benign 0.00
IGL02674:Vps13b APN 15 35639958 missense probably benign 0.41
IGL02690:Vps13b APN 15 35917142 missense probably damaging 1.00
IGL02731:Vps13b APN 15 35917128 missense probably benign 0.00
IGL02739:Vps13b APN 15 35879900 missense probably damaging 1.00
IGL02868:Vps13b APN 15 35884519 missense probably benign 0.03
IGL03081:Vps13b APN 15 35875820 missense probably damaging 0.97
IGL03178:Vps13b APN 15 35869300 missense probably damaging 1.00
IGL03343:Vps13b APN 15 35917170 missense possibly damaging 0.76
IGL03407:Vps13b APN 15 35639866 missense possibly damaging 0.95
IGL03410:Vps13b APN 15 35910340 missense probably benign
FR4449:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4548:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4737:Vps13b UTSW 15 35846957 missense probably damaging 1.00
FR4976:Vps13b UTSW 15 35846957 missense probably damaging 1.00
LCD18:Vps13b UTSW 15 35846957 missense probably damaging 1.00
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0026:Vps13b UTSW 15 35923301 missense possibly damaging 0.62
R0108:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0109:Vps13b UTSW 15 35572119 missense probably benign 0.20
R0116:Vps13b UTSW 15 35423155 missense probably damaging 0.99
R0123:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0124:Vps13b UTSW 15 35576528 critical splice donor site probably null
R0134:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0137:Vps13b UTSW 15 35926219 missense probably benign 0.06
R0195:Vps13b UTSW 15 35471899 missense probably benign 0.00
R0225:Vps13b UTSW 15 35887261 missense probably benign 0.01
R0320:Vps13b UTSW 15 35674828 missense probably damaging 0.98
R0333:Vps13b UTSW 15 35879803 missense probably damaging 1.00
R0336:Vps13b UTSW 15 35455133 nonsense probably null
R0463:Vps13b UTSW 15 35597409 missense probably damaging 0.98
R0466:Vps13b UTSW 15 35445602 nonsense probably null
R0472:Vps13b UTSW 15 35417633 critical splice donor site probably null
R0523:Vps13b UTSW 15 35472050 missense probably benign 0.20
R0602:Vps13b UTSW 15 35422368 missense probably damaging 1.00
R0612:Vps13b UTSW 15 35623657 missense probably benign 0.12
R0627:Vps13b UTSW 15 35371999 nonsense probably null
R0679:Vps13b UTSW 15 35709703 missense possibly damaging 0.73
R0742:Vps13b UTSW 15 35794361 missense probably benign 0.22
R1053:Vps13b UTSW 15 35652363 missense probably damaging 1.00
R1355:Vps13b UTSW 15 35422454 missense probably damaging 1.00
R1386:Vps13b UTSW 15 35923312 missense probably damaging 0.99
R1403:Vps13b UTSW 15 35709122 splice site probably benign
R1453:Vps13b UTSW 15 35422444 missense probably damaging 0.97
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1464:Vps13b UTSW 15 35709484 missense probably benign 0.14
R1511:Vps13b UTSW 15 35839975 missense probably damaging 0.99
R1511:Vps13b UTSW 15 35841573 missense probably benign 0.00
R1513:Vps13b UTSW 15 35438730 nonsense probably null
R1536:Vps13b UTSW 15 35875566 missense probably damaging 0.98
R1537:Vps13b UTSW 15 35792181 missense possibly damaging 0.62
R1558:Vps13b UTSW 15 35534319 missense probably damaging 1.00
R1601:Vps13b UTSW 15 35642436 missense probably benign 0.11
R1653:Vps13b UTSW 15 35607272 nonsense probably null
R1695:Vps13b UTSW 15 35576521 missense probably benign 0.05
R1760:Vps13b UTSW 15 35884619 missense possibly damaging 0.54
R1785:Vps13b UTSW 15 35879791 missense probably damaging 1.00
R1803:Vps13b UTSW 15 35430205 nonsense probably null
R1804:Vps13b UTSW 15 35917137 missense probably damaging 1.00
R1808:Vps13b UTSW 15 35792059 missense probably benign 0.00
R1817:Vps13b UTSW 15 35910642 missense possibly damaging 0.86
R1818:Vps13b UTSW 15 35877577 missense probably benign 0.00
R1836:Vps13b UTSW 15 35910232 missense probably damaging 0.99
R1850:Vps13b UTSW 15 35674959 splice site probably benign
R1884:Vps13b UTSW 15 35430291 splice site probably benign
R1938:Vps13b UTSW 15 35709507 missense probably damaging 1.00
R1955:Vps13b UTSW 15 35925408 critical splice donor site probably null
R1956:Vps13b UTSW 15 35869407 missense probably damaging 1.00
R1958:Vps13b UTSW 15 35878689 missense probably damaging 0.99
R2013:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2014:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2015:Vps13b UTSW 15 35607142 missense probably damaging 0.99
R2038:Vps13b UTSW 15 35884741 missense probably damaging 1.00
R2058:Vps13b UTSW 15 35841447 missense probably damaging 1.00
R2082:Vps13b UTSW 15 35910746 missense possibly damaging 0.70
R2087:Vps13b UTSW 15 35597493 missense probably damaging 0.99
R2124:Vps13b UTSW 15 35646080 missense probably benign 0.08
R2130:Vps13b UTSW 15 35671400 missense probably benign 0.13
R2168:Vps13b UTSW 15 35792188 missense probably damaging 1.00
R2168:Vps13b UTSW 15 35792189 missense probably damaging 1.00
R2171:Vps13b UTSW 15 35887197 missense probably benign 0.44
R2221:Vps13b UTSW 15 35884597 missense probably benign
R2263:Vps13b UTSW 15 35646181 missense probably benign 0.02
R2289:Vps13b UTSW 15 35572105 missense probably damaging 1.00
R2316:Vps13b UTSW 15 35674899 nonsense probably null
R2351:Vps13b UTSW 15 35869311 missense probably damaging 1.00
R2512:Vps13b UTSW 15 35884555 missense probably benign 0.35
R3054:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3055:Vps13b UTSW 15 35646361 missense probably damaging 0.99
R3196:Vps13b UTSW 15 35869395 missense probably damaging 1.00
R3236:Vps13b UTSW 15 35910304 missense probably benign 0.40
R3404:Vps13b UTSW 15 35926054 missense probably damaging 1.00
R3722:Vps13b UTSW 15 35671382 missense probably damaging 0.99
R4077:Vps13b UTSW 15 35455128 missense probably damaging 0.99
R4153:Vps13b UTSW 15 35792027 splice site probably null
R4224:Vps13b UTSW 15 35876419 missense probably damaging 0.99
R4408:Vps13b UTSW 15 35709294 missense probably damaging 0.98
R4431:Vps13b UTSW 15 35770753 missense probably damaging 1.00
R4449:Vps13b UTSW 15 35876793 missense possibly damaging 0.86
R4508:Vps13b UTSW 15 35709673 missense possibly damaging 0.80
R4631:Vps13b UTSW 15 35646132 missense possibly damaging 0.95
R4655:Vps13b UTSW 15 35770689 missense probably benign
R4666:Vps13b UTSW 15 35640544 missense probably benign 0.13
R4684:Vps13b UTSW 15 35646178 missense probably damaging 0.98
R4684:Vps13b UTSW 15 35841341 missense probably benign
R4684:Vps13b UTSW 15 35879821 missense probably benign
R4721:Vps13b UTSW 15 35910718 nonsense probably null
R4771:Vps13b UTSW 15 35910800 missense probably damaging 1.00
R4830:Vps13b UTSW 15 35452224 missense possibly damaging 0.94
R4835:Vps13b UTSW 15 35869372 missense probably damaging 1.00
R4835:Vps13b UTSW 15 35910293 missense probably benign
R4857:Vps13b UTSW 15 35456654 missense probably benign 0.01
R4891:Vps13b UTSW 15 35640515 splice site probably null
R5095:Vps13b UTSW 15 35923202 missense probably damaging 1.00
R5110:Vps13b UTSW 15 35770809 missense probably damaging 0.99
R5147:Vps13b UTSW 15 35456678 missense probably benign 0.32
R5153:Vps13b UTSW 15 35422453 missense probably damaging 0.99
R5257:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5258:Vps13b UTSW 15 35794421 missense possibly damaging 0.75
R5296:Vps13b UTSW 15 35876413 missense probably damaging 1.00
R5386:Vps13b UTSW 15 35640528 critical splice acceptor site probably null
R5396:Vps13b UTSW 15 35886948 missense probably damaging 0.99
R5412:Vps13b UTSW 15 35533385 missense probably damaging 1.00
R5488:Vps13b UTSW 15 35770542 missense probably benign
R5489:Vps13b UTSW 15 35770542 missense probably benign
R5503:Vps13b UTSW 15 35452166 missense probably damaging 0.97
R5575:Vps13b UTSW 15 35929919 missense probably damaging 1.00
R5781:Vps13b UTSW 15 35794035 missense probably damaging 0.97
R5872:Vps13b UTSW 15 35869351 missense possibly damaging 0.56
R5876:Vps13b UTSW 15 35917061 missense probably damaging 0.99
R5994:Vps13b UTSW 15 35875772 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6031:Vps13b UTSW 15 35471968 missense probably damaging 1.00
R6045:Vps13b UTSW 15 35671316 missense probably damaging 0.99
R6143:Vps13b UTSW 15 35668738 missense probably damaging 0.99
R6147:Vps13b UTSW 15 35930031 missense probably benign 0.16
R6218:Vps13b UTSW 15 35770464 missense probably benign 0.00
R6447:Vps13b UTSW 15 35572126 missense probably benign 0.02
R6555:Vps13b UTSW 15 35846847 missense probably damaging 1.00
R6578:Vps13b UTSW 15 35446101 missense probably damaging 0.99
R6640:Vps13b UTSW 15 35617696 missense possibly damaging 0.93
R6645:Vps13b UTSW 15 35910305 missense probably benign 0.25
R6711:Vps13b UTSW 15 35887249 missense probably damaging 1.00
R6727:Vps13b UTSW 15 35770683 missense probably benign 0.19
R6737:Vps13b UTSW 15 35910611 missense probably damaging 1.00
R6844:Vps13b UTSW 15 35877590 missense probably benign 0.06
R6849:Vps13b UTSW 15 35905309 missense probably damaging 1.00
R6861:Vps13b UTSW 15 35576395 missense probably damaging 0.99
R6938:Vps13b UTSW 15 35423198 missense probably damaging 0.99
R6943:Vps13b UTSW 15 35448689 missense possibly damaging 0.95
R6989:Vps13b UTSW 15 35448581 missense probably benign 0.02
X0026:Vps13b UTSW 15 35910646 missense probably damaging 1.00
X0028:Vps13b UTSW 15 35709431 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATTCATGGGTTAGTTACAGCTTGAG -3'
(R):5'- CCTTCTGATGTCCTGGGAAAG -3'

Sequencing Primer
(F):5'- CTTCCCTGAACTTGAATATCATTGTG -3'
(R):5'- GAAAGCTCCGAGTCTGATTTCAGC -3'
Posted On2014-06-23