Incidental Mutation 'R1799:Inpp4a'
ID202882
Institutional Source Beutler Lab
Gene Symbol Inpp4a
Ensembl Gene ENSMUSG00000026113
Gene Nameinositol polyphosphate-4-phosphatase, type I
Synonyms107kDa
MMRRC Submission 039829-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.362) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location37299865-37410736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37392978 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 153 (V153E)
Ref Sequence ENSEMBL: ENSMUSP00000142118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027287] [ENSMUST00000058307] [ENSMUST00000114933] [ENSMUST00000132401] [ENSMUST00000132615] [ENSMUST00000136846] [ENSMUST00000137266] [ENSMUST00000140264] [ENSMUST00000168546] [ENSMUST00000193774]
Predicted Effect probably benign
Transcript: ENSMUST00000027287
AA Change: V786E

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000027287
Gene: ENSMUSG00000026113
AA Change: V786E

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058307
AA Change: V510E

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000057233
Gene: ENSMUSG00000026113
AA Change: V510E

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114933
AA Change: V521E

PolyPhen 2 Score 0.261 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000110583
Gene: ENSMUSG00000026113
AA Change: V521E

DomainStartEndE-ValueType
low complexity region 300 325 N/A INTRINSIC
transmembrane domain 662 684 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132401
AA Change: V819E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123071
Gene: ENSMUSG00000026113
AA Change: V819E

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 602 623 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132615
AA Change: V785E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115249
Gene: ENSMUSG00000026113
AA Change: V785E

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 565 590 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136846
AA Change: V785E

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121518
Gene: ENSMUSG00000026113
AA Change: V785E

DomainStartEndE-ValueType
Blast:C2 49 142 9e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 559 584 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137266
AA Change: V824E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121803
Gene: ENSMUSG00000026113
AA Change: V824E

DomainStartEndE-ValueType
Blast:C2 49 142 1e-57 BLAST
SCOP:d1bdya_ 50 168 6e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 607 628 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140264
AA Change: V780E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121107
Gene: ENSMUSG00000026113
AA Change: V780E

DomainStartEndE-ValueType
Blast:C2 49 142 7e-58 BLAST
SCOP:d1bdya_ 50 168 7e-5 SMART
low complexity region 377 391 N/A INTRINSIC
low complexity region 564 589 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168546
AA Change: V510E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130443
Gene: ENSMUSG00000026113
AA Change: V510E

DomainStartEndE-ValueType
transmembrane domain 651 673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000193774
AA Change: V153E

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000142118
Gene: ENSMUSG00000026113
AA Change: V153E

DomainStartEndE-ValueType
Blast:C2 45 87 7e-13 BLAST
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Mg++ independent enzyme that hydrolyzes the 4-position phosphate from the inositol ring of phosphatidylinositol 3,4-bisphosphate, inositol 1,3,4-trisphosphate, and inositol 3,4-bisphosphate. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit small size, ataxia, loss of cerebellar and hippocampal CA1 neurons, and death by 24 days of age from seizures and/or malnutrition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Inpp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Inpp4a APN 1 37388905 missense probably damaging 1.00
IGL01821:Inpp4a APN 1 37377717 missense probably damaging 1.00
IGL02015:Inpp4a APN 1 37389712 missense probably damaging 1.00
IGL02036:Inpp4a APN 1 37377569 intron probably benign
IGL02040:Inpp4a APN 1 37396085 missense probably damaging 0.99
IGL02082:Inpp4a APN 1 37366627 intron probably benign
IGL02318:Inpp4a APN 1 37368303 missense probably damaging 1.00
IGL02555:Inpp4a APN 1 37379968 missense possibly damaging 0.70
IGL02622:Inpp4a APN 1 37379034 missense probably benign 0.26
R0265:Inpp4a UTSW 1 37378986 missense probably damaging 1.00
R0388:Inpp4a UTSW 1 37396160 missense probably damaging 0.96
R0543:Inpp4a UTSW 1 37369492 intron probably benign
R1269:Inpp4a UTSW 1 37389742 missense probably benign 0.01
R1719:Inpp4a UTSW 1 37398799 missense probably damaging 1.00
R2127:Inpp4a UTSW 1 37366919 missense probably benign 0.08
R2143:Inpp4a UTSW 1 37387746 missense probably damaging 1.00
R2174:Inpp4a UTSW 1 37396130 missense probably damaging 1.00
R2258:Inpp4a UTSW 1 37377696 missense probably damaging 1.00
R2327:Inpp4a UTSW 1 37366166 missense probably damaging 0.96
R2437:Inpp4a UTSW 1 37392956 missense probably damaging 1.00
R2897:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R2898:Inpp4a UTSW 1 37366594 missense probably benign 0.07
R4830:Inpp4a UTSW 1 37371780 missense probably damaging 1.00
R4934:Inpp4a UTSW 1 37387841 missense possibly damaging 0.74
R5141:Inpp4a UTSW 1 37380087 missense probably benign 0.17
R5152:Inpp4a UTSW 1 37358535 missense possibly damaging 0.88
R5627:Inpp4a UTSW 1 37367773 missense probably damaging 0.96
R5789:Inpp4a UTSW 1 37372329 missense possibly damaging 0.75
R6004:Inpp4a UTSW 1 37372370 missense probably damaging 0.99
R6107:Inpp4a UTSW 1 37377748 missense probably damaging 0.98
R6180:Inpp4a UTSW 1 37380102 missense probably benign
R6434:Inpp4a UTSW 1 37398838 missense probably damaging 1.00
R6571:Inpp4a UTSW 1 37387758 missense probably damaging 1.00
R6766:Inpp4a UTSW 1 37372341 missense probably damaging 1.00
R6992:Inpp4a UTSW 1 37389691 missense probably damaging 0.98
R7025:Inpp4a UTSW 1 37369423 missense probably benign 0.00
R7126:Inpp4a UTSW 1 37374272 missense not run
Predicted Primers PCR Primer
(F):5'- AGTGAGATTCAGTGGTCTCTGC -3'
(R):5'- AATACTGCAGCGGGATGAGC -3'

Sequencing Primer
(F):5'- AGAAATTCCTCCCTAGTGCTCTAGAG -3'
(R):5'- GATGAGCTGGGCAGTGC -3'
Posted On2014-06-23