Incidental Mutation 'R0092:Slc24a1'
ID20289
Institutional Source Beutler Lab
Gene Symbol Slc24a1
Ensembl Gene ENSMUSG00000034452
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Synonyms
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R0092 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location64922861-64951607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 64948752 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 291 (E291A)
Ref Sequence ENSEMBL: ENSMUSP00000035616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037798]
Predicted Effect unknown
Transcript: ENSMUST00000037798
AA Change: E291A
SMART Domains Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: E291A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Na_Ca_ex 425 569 1.7e-28 PFAM
low complexity region 683 699 N/A INTRINSIC
coiled coil region 747 776 N/A INTRINSIC
coiled coil region 818 847 N/A INTRINSIC
coiled coil region 898 928 N/A INTRINSIC
transmembrane domain 939 956 N/A INTRINSIC
Pfam:Na_Ca_ex 967 1118 1.7e-33 PFAM
Meta Mutation Damage Score 0.064 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Slc24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Slc24a1 APN 9 64928019 missense probably damaging 0.99
IGL01602:Slc24a1 APN 9 64926181 missense probably damaging 1.00
IGL03111:Slc24a1 APN 9 64926326 missense probably damaging 0.98
R0708:Slc24a1 UTSW 9 64947890 missense unknown
R0827:Slc24a1 UTSW 9 64928190 missense probably benign 0.03
R1294:Slc24a1 UTSW 9 64936013 missense unknown
R1613:Slc24a1 UTSW 9 64948696 missense unknown
R2858:Slc24a1 UTSW 9 64949332 missense unknown
R3779:Slc24a1 UTSW 9 64948297 missense unknown
R3899:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R3900:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R4409:Slc24a1 UTSW 9 64948224 missense probably benign 0.39
R4732:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4733:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4745:Slc24a1 UTSW 9 64949476 missense unknown
R4915:Slc24a1 UTSW 9 64947931 missense unknown
R5371:Slc24a1 UTSW 9 64949268 missense unknown
R5448:Slc24a1 UTSW 9 64948327 missense probably benign 0.39
R5540:Slc24a1 UTSW 9 64948581 missense unknown
R5863:Slc24a1 UTSW 9 64928542 missense unknown
R6161:Slc24a1 UTSW 9 64937263 missense unknown
R6810:Slc24a1 UTSW 9 64948323 missense probably benign 0.39
X0063:Slc24a1 UTSW 9 64949143 missense unknown
Predicted Primers PCR Primer
(F):5'- ATGCTTGTCACGCCTGGAGATG -3'
(R):5'- AGAGAATGGTTCTGAACACACCGAC -3'

Sequencing Primer
(F):5'- ATGGGGTCATGGGTACAGC -3'
(R):5'- CGACCTTCTTAACACATGAAGTAG -3'
Posted On2013-04-11