Incidental Mutation 'R1799:Eps15'
ID202915
Institutional Source Beutler Lab
Gene Symbol Eps15
Ensembl Gene ENSMUSG00000028552
Gene Nameepidermal growth factor receptor pathway substrate 15
Synonyms
MMRRC Submission 039829-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location109280268-109387817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 109382837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 492 (D492E)
Ref Sequence ENSEMBL: ENSMUSP00000030281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030281] [ENSMUST00000102729] [ENSMUST00000132165] [ENSMUST00000175776] [ENSMUST00000176251]
Predicted Effect probably damaging
Transcript: ENSMUST00000030281
AA Change: D492E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030281
Gene: ENSMUSG00000028552
AA Change: D492E

DomainStartEndE-ValueType
SCOP:d1bg1a1 37 178 8e-8 SMART
low complexity region 191 202 N/A INTRINSIC
internal_repeat_1 308 341 5.7e-7 PROSPERO
low complexity region 348 371 N/A INTRINSIC
low complexity region 430 440 N/A INTRINSIC
low complexity region 460 478 N/A INTRINSIC
internal_repeat_1 485 517 5.7e-7 PROSPERO
UIM 538 557 3.32e0 SMART
UIM 564 583 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102729
AA Change: D806E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099790
Gene: ENSMUSG00000028552
AA Change: D806E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
internal_repeat_2 622 655 1.25e-5 PROSPERO
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 792 N/A INTRINSIC
internal_repeat_2 799 831 1.25e-5 PROSPERO
UIM 852 871 3.32e0 SMART
UIM 878 897 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132165
AA Change: D673E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118949
Gene: ENSMUSG00000028552
AA Change: D673E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 429 N/A INTRINSIC
low complexity region 529 552 N/A INTRINSIC
low complexity region 611 621 N/A INTRINSIC
low complexity region 641 659 N/A INTRINSIC
UIM 719 738 3.32e0 SMART
UIM 745 764 1.55e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175776
AA Change: D842E

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000135270
Gene: ENSMUSG00000028552
AA Change: D842E

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 253 349 4.38e-48 SMART
EFh 263 291 1.2e1 SMART
EFh 297 325 6.82e1 SMART
coiled coil region 365 538 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
internal_repeat_2 658 691 1.92e-5 PROSPERO
low complexity region 698 721 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 810 828 N/A INTRINSIC
internal_repeat_2 835 867 1.92e-5 PROSPERO
UIM 888 907 3.32e0 SMART
UIM 914 933 1.55e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176251
SMART Domains Protein: ENSMUSP00000135034
Gene: ENSMUSG00000028552

DomainStartEndE-ValueType
EH 8 103 7.03e-29 SMART
EFh 52 80 4.74e-3 SMART
EH 121 215 2.91e-53 SMART
EFh 164 192 4.67e-2 SMART
EH 217 313 1.16e-47 SMART
EFh 227 255 1.2e1 SMART
EFh 261 289 6.82e1 SMART
coiled coil region 329 502 N/A INTRINSIC
low complexity region 505 516 N/A INTRINSIC
low complexity region 662 685 N/A INTRINSIC
low complexity region 744 754 N/A INTRINSIC
low complexity region 774 791 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177140
Predicted Effect probably benign
Transcript: ENSMUST00000177192
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the EGFR pathway. The protein is present at clatherin-coated pits and is involved in receptor-mediated endocytosis of EGF. Notably, this gene is rearranged with the HRX/ALL/MLL gene in acute myelogeneous leukemias. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygotes for a null allele show increased marginal zone B cell number with no changes in precursor cells, proliferation, apoptosis, migration or B cell responses. Homozygotes for a different null allele show decreased mean corpuscular hemoglobin (MCH), decreased MCH concentration, and dermatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Eps15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Eps15 APN 4 109309149 missense probably damaging 0.99
IGL01372:Eps15 APN 4 109322106 missense probably damaging 1.00
IGL01642:Eps15 APN 4 109366473 missense probably benign 0.00
IGL02207:Eps15 APN 4 109304748 splice site probably benign
IGL02394:Eps15 APN 4 109312965 missense probably damaging 1.00
IGL02755:Eps15 APN 4 109329698 missense probably benign 0.17
R0117:Eps15 UTSW 4 109382819 missense probably damaging 0.96
R0414:Eps15 UTSW 4 109366480 missense probably damaging 0.96
R0928:Eps15 UTSW 4 109312963 missense possibly damaging 0.95
R1545:Eps15 UTSW 4 109312329 missense probably benign 0.00
R1581:Eps15 UTSW 4 109363186 missense probably benign 0.15
R1627:Eps15 UTSW 4 109370557 missense probably damaging 1.00
R1756:Eps15 UTSW 4 109312918 nonsense probably null
R1906:Eps15 UTSW 4 109324201 missense possibly damaging 0.89
R1916:Eps15 UTSW 4 109368974 missense probably damaging 1.00
R2042:Eps15 UTSW 4 109304767 missense probably damaging 0.98
R2046:Eps15 UTSW 4 109370596 missense probably damaging 1.00
R2163:Eps15 UTSW 4 109370669 missense probably damaging 0.98
R2213:Eps15 UTSW 4 109361220 missense probably damaging 1.00
R2362:Eps15 UTSW 4 109361230 missense probably benign 0.06
R3151:Eps15 UTSW 4 109366222 missense probably benign 0.02
R3712:Eps15 UTSW 4 109309177 missense probably damaging 1.00
R3727:Eps15 UTSW 4 109370685 splice site probably benign
R4361:Eps15 UTSW 4 109380031 critical splice donor site probably null
R4381:Eps15 UTSW 4 109366530 unclassified probably benign
R4466:Eps15 UTSW 4 109366530 unclassified probably benign
R4740:Eps15 UTSW 4 109343190 missense probably damaging 1.00
R4797:Eps15 UTSW 4 109366530 unclassified probably benign
R4799:Eps15 UTSW 4 109366530 unclassified probably benign
R4801:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4802:Eps15 UTSW 4 109324217 missense possibly damaging 0.95
R4864:Eps15 UTSW 4 109366530 unclassified probably benign
R4954:Eps15 UTSW 4 109370678 splice site probably null
R5134:Eps15 UTSW 4 109366530 unclassified probably benign
R5386:Eps15 UTSW 4 109321225 missense possibly damaging 0.48
R5768:Eps15 UTSW 4 109363176 splice site probably null
R5870:Eps15 UTSW 4 109361310 missense probably damaging 0.98
R6245:Eps15 UTSW 4 109382866 missense possibly damaging 0.66
R6290:Eps15 UTSW 4 109363198 missense probably benign 0.37
R6291:Eps15 UTSW 4 109305703 frame shift probably null
R6493:Eps15 UTSW 4 109368948 missense probably damaging 1.00
R6813:Eps15 UTSW 4 109280402 utr 5 prime probably null
R6883:Eps15 UTSW 4 109309164 missense probably damaging 0.99
R6913:Eps15 UTSW 4 109361230 missense probably benign 0.06
X0023:Eps15 UTSW 4 109343357 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTTTGAGAAAGTGCCGTAG -3'
(R):5'- TGTTTGCAAGAACCACAATGAC -3'

Sequencing Primer
(F):5'- GTAGGCTTTTGCTCTGTACACCAC -3'
(R):5'- GTAATGAAGTCATCTAAGAACCAGC -3'
Posted On2014-06-23