Incidental Mutation 'R0092:Col6a4'
ID20293
Institutional Source Beutler Lab
Gene Symbol Col6a4
Ensembl Gene ENSMUSG00000032572
Gene Namecollagen, type VI, alpha 4
SynonymsVwa6, 1110001D15Rik, EG235580, Dvwa
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock #R0092 (G1)
Quality Score162
Status Validated (trace)
Chromosome9
Chromosomal Location105989454-106096783 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106013314 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1927 (E1927V)
Ref Sequence ENSEMBL: ENSMUSP00000112472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121963]
Predicted Effect probably benign
Transcript: ENSMUST00000121963
AA Change: E1927V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000112472
Gene: ENSMUSG00000032572
AA Change: E1927V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VWA 32 211 2.44e-35 SMART
VWA 233 410 8.67e-50 SMART
VWA 428 604 2.74e-29 SMART
VWA 632 816 4.78e-20 SMART
VWA 847 1019 3.02e-40 SMART
VWA 1028 1204 3.17e-43 SMART
VWA 1210 1391 4.73e-1 SMART
low complexity region 1444 1462 N/A INTRINSIC
PDB:3HR2|B 1469 1593 3e-7 PDB
low complexity region 1594 1622 N/A INTRINSIC
low complexity region 1625 1643 N/A INTRINSIC
low complexity region 1649 1671 N/A INTRINSIC
Pfam:Collagen 1684 1748 1.4e-9 PFAM
VWA 1774 1953 2.18e-14 SMART
VWA 1980 2174 1.89e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213434
Predicted Effect unknown
Transcript: ENSMUST00000218471
AA Change: E44V
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Col6a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Col6a4 APN 9 106022896 missense probably benign 0.00
IGL00691:Col6a4 APN 9 106057407 missense probably damaging 1.00
IGL01508:Col6a4 APN 9 106013605 missense possibly damaging 0.95
IGL01580:Col6a4 APN 9 106068198 missense probably damaging 1.00
IGL01610:Col6a4 APN 9 106047707 splice site probably benign
IGL01813:Col6a4 APN 9 106077253 missense probably damaging 1.00
IGL01933:Col6a4 APN 9 106060114 missense probably benign 0.04
IGL01973:Col6a4 APN 9 106062894 missense probably damaging 1.00
IGL02053:Col6a4 APN 9 106063095 missense possibly damaging 0.92
IGL02063:Col6a4 APN 9 106057418 missense probably benign 0.01
IGL02065:Col6a4 APN 9 106077103 missense probably damaging 0.99
IGL02106:Col6a4 APN 9 106063105 missense possibly damaging 0.95
IGL02220:Col6a4 APN 9 106062942 missense possibly damaging 0.91
IGL02228:Col6a4 APN 9 106068078 missense probably benign
IGL02234:Col6a4 APN 9 106013432 missense possibly damaging 0.92
IGL02294:Col6a4 APN 9 106066732 missense probably benign 0.04
IGL02314:Col6a4 APN 9 105997156 missense probably damaging 0.99
IGL03065:Col6a4 APN 9 106041164 splice site probably benign
IGL03086:Col6a4 APN 9 106082862 splice site probably benign
IGL03185:Col6a4 APN 9 106019454 missense probably damaging 0.97
R0095:Col6a4 UTSW 9 106075356 missense probably benign 0.03
R0230:Col6a4 UTSW 9 106072366 missense probably benign 0.11
R0359:Col6a4 UTSW 9 105997146 missense probably benign
R0415:Col6a4 UTSW 9 106075080 missense probably damaging 0.99
R0433:Col6a4 UTSW 9 106067994 missense probably damaging 0.99
R0450:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0469:Col6a4 UTSW 9 106080547 missense probably damaging 1.00
R0490:Col6a4 UTSW 9 106013770 missense probably damaging 0.99
R0621:Col6a4 UTSW 9 106066791 missense probably damaging 0.97
R0667:Col6a4 UTSW 9 106029959 splice site probably benign
R0681:Col6a4 UTSW 9 106067144 nonsense probably null
R0690:Col6a4 UTSW 9 106028187 splice site probably benign
R0714:Col6a4 UTSW 9 106017903 unclassified probably benign
R0788:Col6a4 UTSW 9 106071998 missense probably benign 0.15
R1036:Col6a4 UTSW 9 106068198 missense probably damaging 1.00
R1296:Col6a4 UTSW 9 106062853 missense possibly damaging 0.47
R1386:Col6a4 UTSW 9 106062945 missense probably benign 0.15
R1484:Col6a4 UTSW 9 106013302 critical splice donor site probably null
R1528:Col6a4 UTSW 9 106075220 missense probably damaging 0.99
R1555:Col6a4 UTSW 9 106000886 missense possibly damaging 0.93
R1622:Col6a4 UTSW 9 105997135 missense probably benign 0.01
R1653:Col6a4 UTSW 9 106072409 missense probably damaging 0.99
R1720:Col6a4 UTSW 9 106026472 missense probably damaging 1.00
R1768:Col6a4 UTSW 9 106080100 missense probably benign
R1941:Col6a4 UTSW 9 106075010 missense probably benign 0.00
R2092:Col6a4 UTSW 9 106060331 missense probably damaging 1.00
R2134:Col6a4 UTSW 9 106066661 missense probably benign 0.09
R2149:Col6a4 UTSW 9 106076929 missense probably benign 0.00
R2174:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2204:Col6a4 UTSW 9 106060132 missense probably damaging 0.98
R2248:Col6a4 UTSW 9 106079959 missense probably benign 0.15
R2568:Col6a4 UTSW 9 106063076 missense possibly damaging 0.90
R3750:Col6a4 UTSW 9 106020665 critical splice acceptor site probably null
R3751:Col6a4 UTSW 9 106072114 missense probably damaging 0.98
R3776:Col6a4 UTSW 9 106051701 nonsense probably null
R3872:Col6a4 UTSW 9 106013659 missense possibly damaging 0.95
R4043:Col6a4 UTSW 9 106072411 nonsense probably null
R4056:Col6a4 UTSW 9 106026466 missense probably damaging 0.98
R4212:Col6a4 UTSW 9 106075370 missense probably benign 0.28
R4417:Col6a4 UTSW 9 106072016 missense probably damaging 0.99
R4683:Col6a4 UTSW 9 106080130 missense probably benign 0.00
R4719:Col6a4 UTSW 9 106068252 missense probably damaging 0.99
R4791:Col6a4 UTSW 9 106080202 missense possibly damaging 0.68
R4833:Col6a4 UTSW 9 106071979 missense probably benign 0.00
R4886:Col6a4 UTSW 9 106060072 missense probably benign 0.00
R4998:Col6a4 UTSW 9 105990778 utr 3 prime probably benign
R5091:Col6a4 UTSW 9 106075063 missense probably damaging 1.00
R5113:Col6a4 UTSW 9 106066960 missense possibly damaging 0.89
R5129:Col6a4 UTSW 9 106013377 missense probably damaging 0.98
R5231:Col6a4 UTSW 9 106025531 missense probably damaging 0.96
R5297:Col6a4 UTSW 9 106074867 missense probably benign 0.02
R5352:Col6a4 UTSW 9 106061544 missense probably damaging 1.00
R5438:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5518:Col6a4 UTSW 9 106072188 missense possibly damaging 0.68
R5657:Col6a4 UTSW 9 106072198 missense probably damaging 0.99
R5660:Col6a4 UTSW 9 105996116 missense probably benign 0.01
R5662:Col6a4 UTSW 9 106068001 missense probably damaging 0.99
R5777:Col6a4 UTSW 9 106013696 missense possibly damaging 0.95
R5800:Col6a4 UTSW 9 106080275 missense probably damaging 0.99
R5929:Col6a4 UTSW 9 106063044 missense probably benign 0.15
R5999:Col6a4 UTSW 9 106067921 missense probably benign 0.11
R6243:Col6a4 UTSW 9 106013390 missense possibly damaging 0.95
R6285:Col6a4 UTSW 9 106074986 missense probably damaging 0.96
R6288:Col6a4 UTSW 9 106068263 missense probably damaging 0.99
R6361:Col6a4 UTSW 9 106066703 missense probably benign 0.28
R6485:Col6a4 UTSW 9 106076870 critical splice donor site probably null
R6490:Col6a4 UTSW 9 106074992 nonsense probably null
R6537:Col6a4 UTSW 9 106067954 missense possibly damaging 0.87
R6598:Col6a4 UTSW 9 106000412 missense probably damaging 0.99
R6643:Col6a4 UTSW 9 106000631 missense probably damaging 0.96
R6905:Col6a4 UTSW 9 106060318 splice site probably null
R6944:Col6a4 UTSW 9 106072171 missense probably damaging 0.98
X0025:Col6a4 UTSW 9 106000455 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATTCATGCGCCTCCTAAGAGCC -3'
(R):5'- TTGTCAGACCATCGGGGAAAAGC -3'

Sequencing Primer
(F):5'- AGCCAGGTCATCTGTAGTAGC -3'
(R):5'- GAAAAGCTGCCCTTCTGC -3'
Posted On2013-04-11