Incidental Mutation 'R1799:Atp2a1'
ID202940
Institutional Source Beutler Lab
Gene Symbol Atp2a1
Ensembl Gene ENSMUSG00000030730
Gene NameATPase, Ca++ transporting, cardiac muscle, fast twitch 1
SynonymsSERCA1
MMRRC Submission 039829-MU
Accession Numbers

Genbank: NM_007504.2; Ensembl: ENSMUST00000032974

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126445858-126463108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126450142 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 576 (M576K)
Ref Sequence ENSEMBL: ENSMUSP00000032974 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032974] [ENSMUST00000106405] [ENSMUST00000106407]
Predicted Effect probably benign
Transcript: ENSMUST00000032974
AA Change: M576K

PolyPhen 2 Score 0.273 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000032974
Gene: ENSMUSG00000030730
AA Change: M576K

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.39e-16 SMART
Pfam:E1-E2_ATPase 92 340 1.5e-66 PFAM
Pfam:Hydrolase 345 715 7.5e-20 PFAM
Pfam:HAD 348 712 1.2e-18 PFAM
Pfam:Cation_ATPase 418 528 3.2e-23 PFAM
Pfam:Hydrolase_3 683 747 2.3e-7 PFAM
Pfam:Cation_ATPase_C 784 987 4.8e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106405
SMART Domains Protein: ENSMUSP00000102013
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 2 107 1.4e-41 PFAM
low complexity region 139 158 N/A INTRINSIC
low complexity region 175 194 N/A INTRINSIC
Pfam:Rabaptin 196 311 5.9e-10 PFAM
Pfam:Rab5-bind 289 456 4.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106407
SMART Domains Protein: ENSMUSP00000102015
Gene: ENSMUSG00000030727

DomainStartEndE-ValueType
Pfam:Rabaptin 13 171 1.4e-39 PFAM
low complexity region 182 201 N/A INTRINSIC
low complexity region 218 237 N/A INTRINSIC
Pfam:Rab5-bind 274 487 4.1e-21 PFAM
Pfam:Rab5-bind 469 531 1.6e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133300
Predicted Effect probably benign
Transcript: ENSMUST00000146973
SMART Domains Protein: ENSMUSP00000119018
Gene: ENSMUSG00000030730

DomainStartEndE-ValueType
Pfam:Cation_ATPase_C 6 132 6.3e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151304
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype Lethality: D1
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in muscular excitation and contraction. Mutations in this gene cause some autosomal recessive forms of Brody disease, characterized by increasing impairment of muscular relaxation during exercise. Alternative splicing results in three transcript variants encoding different isoforms. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in perinatal lethality. Mutant neonates display respiratory distress, progressive cyanosis, and die within 30 minutes-2 hours after birth. Lung tissues and the diaphragm muscle show aberrant morphology. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(1)

Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Atp2a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Atp2a1 APN 7 126447216 nonsense probably null
IGL00474:Atp2a1 APN 7 126450294 nonsense probably null
IGL00500:Atp2a1 APN 7 126447216 nonsense probably null
IGL01112:Atp2a1 APN 7 126450307 missense probably benign 0.13
IGL01380:Atp2a1 APN 7 126448770 missense possibly damaging 0.84
IGL01503:Atp2a1 APN 7 126448578 missense probably damaging 1.00
IGL01630:Atp2a1 APN 7 126450265 missense probably benign 0.00
IGL01679:Atp2a1 APN 7 126456809 missense probably benign 0.00
IGL01729:Atp2a1 APN 7 126457934 missense probably damaging 0.99
IGL02290:Atp2a1 APN 7 126452649 splice site probably benign
IGL02929:Atp2a1 APN 7 126456944 missense probably damaging 1.00
IGL02951:Atp2a1 APN 7 126450227 missense possibly damaging 0.58
IGL03249:Atp2a1 APN 7 126462805 missense probably benign 0.12
1mM(1):Atp2a1 UTSW 7 126446909 missense probably damaging 1.00
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0052:Atp2a1 UTSW 7 126457897 splice site probably benign
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0070:Atp2a1 UTSW 7 126447452 missense probably benign 0.03
R0121:Atp2a1 UTSW 7 126457944 missense probably damaging 1.00
R0398:Atp2a1 UTSW 7 126450418 unclassified probably benign
R0578:Atp2a1 UTSW 7 126450143 missense probably benign
R0626:Atp2a1 UTSW 7 126446990 critical splice acceptor site probably null
R0739:Atp2a1 UTSW 7 126448256 missense possibly damaging 0.87
R1558:Atp2a1 UTSW 7 126452672 missense possibly damaging 0.88
R1700:Atp2a1 UTSW 7 126462909 missense probably damaging 1.00
R1748:Atp2a1 UTSW 7 126459608 missense possibly damaging 0.67
R1808:Atp2a1 UTSW 7 126453401 missense probably damaging 0.97
R2058:Atp2a1 UTSW 7 126447672 missense possibly damaging 0.60
R2143:Atp2a1 UTSW 7 126448725 nonsense probably null
R2427:Atp2a1 UTSW 7 126446583 makesense probably null
R3113:Atp2a1 UTSW 7 126448369 missense probably damaging 1.00
R4501:Atp2a1 UTSW 7 126453383 missense probably benign 0.00
R4604:Atp2a1 UTSW 7 126448623 missense probably damaging 0.96
R4934:Atp2a1 UTSW 7 126453428 missense probably benign
R4939:Atp2a1 UTSW 7 126450116 missense probably benign
R5646:Atp2a1 UTSW 7 126453105 missense probably benign
R6093:Atp2a1 UTSW 7 126446921 missense probably damaging 1.00
R6556:Atp2a1 UTSW 7 126450262 missense probably benign 0.37
R6908:Atp2a1 UTSW 7 126448535 critical splice donor site probably null
R6911:Atp2a1 UTSW 7 126456836 missense probably damaging 1.00
X0022:Atp2a1 UTSW 7 126448250 missense possibly damaging 0.49
X0060:Atp2a1 UTSW 7 126462882 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- ACAGGACACAGCCGTTCATC -3'
(R):5'- TTCTGAACCCTGGAAGGCAG -3'

Sequencing Primer
(F):5'- GTTCATCTGACACACTGTACTAGGG -3'
(R):5'- CAGGCAGGGATCTCGGAATTCTG -3'
Posted On2014-06-23