Incidental Mutation 'R0092:Ctnnb1'
ID20295
Institutional Source Beutler Lab
Gene Symbol Ctnnb1
Ensembl Gene ENSMUSG00000006932
Gene Namecatenin (cadherin associated protein), beta 1
Synonymsbeta-catenin, Catnb, beta catenin
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0092 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120929216-120960507 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 120952863 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 314 (I314S)
Ref Sequence ENSEMBL: ENSMUSP00000136294 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007130] [ENSMUST00000130466] [ENSMUST00000130845] [ENSMUST00000145093] [ENSMUST00000154356] [ENSMUST00000163844] [ENSMUST00000178812]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007130
AA Change: I314S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000007130
Gene: ENSMUSG00000006932
AA Change: I314S

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126633
Predicted Effect probably benign
Transcript: ENSMUST00000130466
Predicted Effect probably benign
Transcript: ENSMUST00000130845
SMART Domains Protein: ENSMUSP00000116365
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 80 2e-43 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000133689
SMART Domains Protein: ENSMUSP00000128564
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
Blast:ARM 2 41 2e-20 BLAST
Pfam:Arm 42 82 4.4e-9 PFAM
Blast:ARM 83 123 9e-10 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139138
Predicted Effect probably benign
Transcript: ENSMUST00000145093
SMART Domains Protein: ENSMUSP00000120132
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 174 1e-113 PDB
SCOP:d1gw5a_ 90 172 5e-8 SMART
Blast:ARM 141 174 4e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000154356
AA Change: I314S

PolyPhen 2 Score 0.625 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000125763
Gene: ENSMUSG00000006932
AA Change: I314S

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 562 3e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154687
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156911
Predicted Effect probably benign
Transcript: ENSMUST00000163844
SMART Domains Protein: ENSMUSP00000126905
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
PDB:2Z6G|A 1 72 2e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000169931
SMART Domains Protein: ENSMUSP00000128858
Gene: ENSMUSG00000006932

DomainStartEndE-ValueType
ARM 2 36 3.8e1 SMART
ARM 41 82 7.34e-3 SMART
ARM 83 144 1.92e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000170729
AA Change: H125Q
SMART Domains Protein: ENSMUSP00000130471
Gene: ENSMUSG00000006932
AA Change: H125Q

DomainStartEndE-ValueType
Blast:ARM 2 35 4e-15 BLAST
PDB:3SLA|E 2 87 1e-57 PDB
SCOP:d1jdha_ 2 89 2e-12 SMART
Blast:ARM 36 78 2e-23 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000178812
AA Change: I314S

PolyPhen 2 Score 0.777 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000136294
Gene: ENSMUSG00000006932
AA Change: I314S

DomainStartEndE-ValueType
ARM 141 180 1.92e1 SMART
ARM 181 223 6.29e-2 SMART
ARM 224 264 1.23e-4 SMART
ARM 265 306 7.34e-3 SMART
ARM 308 349 2.48e0 SMART
ARM 350 390 1.48e-7 SMART
ARM 392 429 3.18e1 SMART
ARM 430 473 1.54e-5 SMART
ARM 478 519 7.34e-3 SMART
ARM 520 582 3.34e-6 SMART
ARM 583 623 2.82e-4 SMART
ARM 624 664 1.78e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198187
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213408
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: This gene encodes not only an important cytoplasmic component of the classical cadherin adhesion complex that forms the adherens junction in epithelia and mediates cell-cell adhesion in many other tissues but also a key signaling molecule in the canonical Wnt signaling pathway that controls cell growth and differentiation during both normal development and tumorigenesis. The gene product contains a central armadillo-repeat containing domain through which it binds the cytoplasmic tail of classical cadherins; meanwhile, it also binds alpha-catenin, which further links the cadherin complex to the actin cytoskeleton either directly or indirectly. Beta-catenin is therefore necessary for the adhesive function of classical cadherins. Another key function of this protein is to mediate the canonical Wnt signaling pathway and regulate gene transcription. Without Wnt signal, cytoplasmic beta-catenin that is not associated with the cadherin complex is quickly phosphorylated at the N-terminal Ser/Thr residues by the so called degradation complex containing axin, adenomatous polyposis coli (APC), casein kinase I, and GSK3B, then ubiquitylated by beta-TrCP, and degraded by the proteasome. However, in the presence of Wnt signal, the degradation complex is disrupted and the stabilized cytoplasmic beta-catenin translocates into the nucleus, where it binds various transcription factors and, together with these factors, regulates the transcription of many downstream genes. Mutations of this gene have been linked with various types of tumors. Alternatively spliced variants have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null embryos show anterior-posterior axis formation anomalies, but develop to E7. Multiple conditional mutations have shown defects in distinct stem cell types that result in proliferation defects, such as intestinal polyps, brain and spinal cord size anomalies, etc. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Ctnnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0326:Ctnnb1 UTSW 9 120951712 missense probably benign 0.01
R0561:Ctnnb1 UTSW 9 120951722 missense probably damaging 0.97
R1017:Ctnnb1 UTSW 9 120950728 missense probably damaging 0.99
R1918:Ctnnb1 UTSW 9 120951034 missense possibly damaging 0.80
R3892:Ctnnb1 UTSW 9 120950514 splice site probably benign
R3915:Ctnnb1 UTSW 9 120955651 missense probably benign 0.00
R4869:Ctnnb1 UTSW 9 120952994 missense possibly damaging 0.93
R5707:Ctnnb1 UTSW 9 120955168 missense probably benign 0.01
R6744:Ctnnb1 UTSW 9 120952959 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAGAATTGTAGCACAGGAGTCAC -3'
(R):5'- TTGCTTACTGAAAGGAAGCCTGGAC -3'

Sequencing Primer
(F):5'- TTGTAGCACAGGAGTCACATACC -3'
(R):5'- TCTTCTATCACTGGGGAGAACAC -3'
Posted On2013-04-11