Incidental Mutation 'R1799:Dapk1'
ID202961
Institutional Source Beutler Lab
Gene Symbol Dapk1
Ensembl Gene ENSMUSG00000021559
Gene Namedeath associated protein kinase 1
SynonymsDAP-Kinase, 2310039H24Rik, D13Ucla1, 2810425C21Rik
MMRRC Submission 039829-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location60601947-60763191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 60719654 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 225 (T225I)
Ref Sequence ENSEMBL: ENSMUSP00000153607 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044083] [ENSMUST00000077453] [ENSMUST00000226059]
Predicted Effect probably damaging
Transcript: ENSMUST00000044083
AA Change: T225I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040825
Gene: ENSMUSG00000021559
AA Change: T225I

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077453
AA Change: T225I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076666
Gene: ENSMUSG00000021559
AA Change: T225I

DomainStartEndE-ValueType
S_TKc 13 275 6.35e-99 SMART
low complexity region 295 306 N/A INTRINSIC
ANK 378 407 5.09e-2 SMART
ANK 411 440 6.61e-1 SMART
ANK 444 473 7.64e-6 SMART
ANK 477 506 2.13e-4 SMART
ANK 510 539 1.31e-4 SMART
ANK 543 572 7.83e-3 SMART
ANK 576 605 8.52e-4 SMART
ANK 609 638 1.85e-4 SMART
ANK 642 671 7.29e2 SMART
low complexity region 711 725 N/A INTRINSIC
Pfam:COR 984 1176 4.2e-10 PFAM
DEATH 1299 1396 2.65e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224340
Predicted Effect probably benign
Transcript: ENSMUST00000224789
Predicted Effect probably damaging
Transcript: ENSMUST00000226059
AA Change: T225I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Death-associated protein kinase 1 is a positive mediator of gamma-interferon induced programmed cell death. DAPK1 encodes a structurally unique 160-kD calmodulin dependent serine-threonine kinase that carries 8 ankyrin repeats and 2 putative P-loop consensus sites. It is a tumor suppressor candidate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele show decreased sensitivity to ER stress-induced cell death and reduced tunicamycin-induced kidney damage. Mice homozygous for a gene trapped allele show decreased infarct size and neuronal death with improved neurological scores after ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Dapk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dapk1 APN 13 60761040 missense probably benign 0.23
IGL00500:Dapk1 APN 13 60760804 missense probably damaging 0.96
IGL00801:Dapk1 APN 13 60761248 missense probably benign 0.00
IGL00903:Dapk1 APN 13 60761397 missense probably damaging 0.99
IGL01468:Dapk1 APN 13 60760798 missense probably benign
IGL01535:Dapk1 APN 13 60731031 splice site probably benign
IGL01755:Dapk1 APN 13 60761175 missense probably damaging 0.97
IGL01755:Dapk1 APN 13 60761176 missense possibly damaging 0.63
IGL01862:Dapk1 APN 13 60726610 missense probably benign 0.39
IGL01985:Dapk1 APN 13 60736260 missense probably damaging 1.00
IGL02124:Dapk1 APN 13 60730882 missense probably benign
IGL02376:Dapk1 APN 13 60696394 missense probably benign 0.00
IGL02449:Dapk1 APN 13 60719770 splice site probably benign
IGL02490:Dapk1 APN 13 60749334 missense probably damaging 1.00
IGL02503:Dapk1 APN 13 60761807 nonsense probably null
IGL02516:Dapk1 APN 13 60696347 missense probably damaging 1.00
IGL02544:Dapk1 APN 13 60751217 missense probably benign
IGL02604:Dapk1 APN 13 60748320 missense probably benign
IGL03035:Dapk1 APN 13 60716773 missense probably damaging 0.99
H8562:Dapk1 UTSW 13 60761312 missense probably damaging 0.98
P0026:Dapk1 UTSW 13 60718149 splice site probably benign
R0116:Dapk1 UTSW 13 60761100 missense probably benign
R0165:Dapk1 UTSW 13 60761593 missense probably benign 0.39
R0357:Dapk1 UTSW 13 60729558 nonsense probably null
R0446:Dapk1 UTSW 13 60725287 splice site probably null
R0502:Dapk1 UTSW 13 60730848 synonymous probably null
R0503:Dapk1 UTSW 13 60730848 synonymous probably null
R0597:Dapk1 UTSW 13 60761384 missense probably benign 0.40
R0614:Dapk1 UTSW 13 60718132 missense probably damaging 1.00
R0751:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R0930:Dapk1 UTSW 13 60757448 missense probably benign 0.14
R1023:Dapk1 UTSW 13 60730985 missense probably damaging 1.00
R1033:Dapk1 UTSW 13 60721865 critical splice donor site probably null
R1101:Dapk1 UTSW 13 60716785 missense probably damaging 1.00
R1184:Dapk1 UTSW 13 60696298 missense probably damaging 1.00
R1430:Dapk1 UTSW 13 60754143 missense probably benign 0.28
R1630:Dapk1 UTSW 13 60729531 missense probably damaging 0.99
R1681:Dapk1 UTSW 13 60718464 critical splice donor site probably null
R2012:Dapk1 UTSW 13 60721857 missense probably damaging 1.00
R2068:Dapk1 UTSW 13 60751208 missense probably damaging 1.00
R2131:Dapk1 UTSW 13 60729531 missense possibly damaging 0.91
R2131:Dapk1 UTSW 13 60761667 missense possibly damaging 0.80
R2154:Dapk1 UTSW 13 60729503 missense probably benign 0.36
R2288:Dapk1 UTSW 13 60761749 missense probably damaging 1.00
R2312:Dapk1 UTSW 13 60757353 missense probably damaging 0.99
R2362:Dapk1 UTSW 13 60730931 missense probably damaging 0.98
R2400:Dapk1 UTSW 13 60752216 missense probably benign 0.34
R2909:Dapk1 UTSW 13 60716817 critical splice donor site probably null
R2926:Dapk1 UTSW 13 60719750 missense possibly damaging 0.58
R3741:Dapk1 UTSW 13 60748200 missense probably benign 0.09
R3810:Dapk1 UTSW 13 60760689 missense probably damaging 0.98
R4374:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4375:Dapk1 UTSW 13 60761589 missense probably benign
R4377:Dapk1 UTSW 13 60719684 missense probably benign 0.01
R4490:Dapk1 UTSW 13 60718128 missense probably benign 0.26
R4576:Dapk1 UTSW 13 60721822 missense probably benign 0.13
R4599:Dapk1 UTSW 13 60718047 missense probably benign 0.22
R4682:Dapk1 UTSW 13 60751147 missense probably benign 0.41
R4717:Dapk1 UTSW 13 60726662 critical splice donor site probably null
R4775:Dapk1 UTSW 13 60749342 missense probably benign 0.02
R4790:Dapk1 UTSW 13 60723105 frame shift probably null
R4897:Dapk1 UTSW 13 60761786 missense probably benign 0.01
R4931:Dapk1 UTSW 13 60760960 missense probably benign 0.04
R5113:Dapk1 UTSW 13 60721778 missense probably benign 0.01
R5503:Dapk1 UTSW 13 60725312 missense probably benign 0.15
R5948:Dapk1 UTSW 13 60729395 missense probably damaging 0.97
R6012:Dapk1 UTSW 13 60761662 missense probably benign 0.00
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6035:Dapk1 UTSW 13 60761199 missense possibly damaging 0.46
R6268:Dapk1 UTSW 13 60761766 missense possibly damaging 0.91
R6330:Dapk1 UTSW 13 60761326 missense probably benign 0.01
R6331:Dapk1 UTSW 13 60729442 nonsense probably null
R6553:Dapk1 UTSW 13 60761161 missense probably damaging 0.99
R6598:Dapk1 UTSW 13 60761347 missense probably benign 0.03
R6602:Dapk1 UTSW 13 60749204 missense probably benign 0.20
R6640:Dapk1 UTSW 13 60716814 missense probably damaging 0.99
R6684:Dapk1 UTSW 13 60760894 missense probably damaging 1.00
R6747:Dapk1 UTSW 13 60725340 missense probably benign 0.22
R6799:Dapk1 UTSW 13 60752235 missense probably benign
R6809:Dapk1 UTSW 13 60751289 missense probably benign 0.00
R6915:Dapk1 UTSW 13 60696442 missense probably damaging 1.00
R6949:Dapk1 UTSW 13 60736324 missense probably benign 0.11
R6979:Dapk1 UTSW 13 60748281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATTGGATTCTGACGTGACTC -3'
(R):5'- CGGAACAGTAAGGGTCTGAC -3'

Sequencing Primer
(F):5'- GATTGGATTCTGACGTGACTCATTCC -3'
(R):5'- CCAGACACAGAACAGGTGCTG -3'
Posted On2014-06-23