Incidental Mutation 'R1799:Piezo2'
ID202992
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Namepiezo-type mechanosensitive ion channel component 2
SynonymsFam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 039829-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1799 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location63010213-63387183 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63108087 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 690 (Y690C)
Ref Sequence ENSEMBL: ENSMUSP00000138758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046860] [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
Predicted Effect probably benign
Transcript: ENSMUST00000046860
SMART Domains Protein: ENSMUSP00000036099
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000047480
AA Change: Y690C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: Y690C

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182166
Predicted Effect probably damaging
Transcript: ENSMUST00000182233
AA Change: Y458C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482
AA Change: Y458C

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000183217
AA Change: Y690C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: Y690C

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Atrx T C X: 105,847,629 Q1536R probably damaging Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1071V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4899:Piezo2 UTSW 18 63078791 missense possibly damaging 0.84
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TTACTGACCTGGTACAAGGCC -3'
(R):5'- AGCTCCAAGATGTACAAGTGG -3'

Sequencing Primer
(F):5'- TGTTACTGACCTGGTACAAGGCC -3'
(R):5'- CTCCAAGATGTACAAGTGGAAGGG -3'
Posted On2014-06-23