Incidental Mutation 'R1799:Atrx'
ID202995
Institutional Source Beutler Lab
Gene Symbol Atrx
Ensembl Gene ENSMUSG00000031229
Gene NameATRX, chromatin remodeler
SynonymsDXHXS6677E, Rad54, 4833408C14Rik, Hp1bp2, Xnp, HP1-BP38, XH2
MMRRC Submission 039829-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R1799 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location105797615-105929403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105847629 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1536 (Q1536R)
Ref Sequence ENSEMBL: ENSMUSP00000109203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113573] [ENSMUST00000198209]
Predicted Effect probably damaging
Transcript: ENSMUST00000113573
AA Change: Q1536R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109203
Gene: ENSMUSG00000031229
AA Change: Q1536R

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
RING 219 267 4.61e-1 SMART
low complexity region 312 322 N/A INTRINSIC
low complexity region 774 789 N/A INTRINSIC
low complexity region 822 837 N/A INTRINSIC
low complexity region 929 946 N/A INTRINSIC
low complexity region 1021 1039 N/A INTRINSIC
low complexity region 1130 1143 N/A INTRINSIC
low complexity region 1145 1165 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
low complexity region 1238 1245 N/A INTRINSIC
low complexity region 1264 1279 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1341 1354 N/A INTRINSIC
low complexity region 1373 1386 N/A INTRINSIC
low complexity region 1407 1416 N/A INTRINSIC
low complexity region 1430 1454 N/A INTRINSIC
coiled coil region 1472 1511 N/A INTRINSIC
DEXDc 1541 1761 2.44e-25 SMART
low complexity region 1898 1932 N/A INTRINSIC
low complexity region 1947 1959 N/A INTRINSIC
low complexity region 1969 1982 N/A INTRINSIC
HELICc 2031 2138 6.1e-17 SMART
low complexity region 2245 2266 N/A INTRINSIC
low complexity region 2397 2413 N/A INTRINSIC
low complexity region 2452 2461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123174
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142235
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155445
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196998
Predicted Effect probably benign
Transcript: ENSMUST00000198209
SMART Domains Protein: ENSMUSP00000142726
Gene: ENSMUSG00000031229

DomainStartEndE-ValueType
low complexity region 50 67 N/A INTRINSIC
low complexity region 142 160 N/A INTRINSIC
internal_repeat_1 171 196 2.95e-5 PROSPERO
internal_repeat_1 218 241 2.95e-5 PROSPERO
low complexity region 251 264 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
low complexity region 300 315 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 385 400 N/A INTRINSIC
low complexity region 422 431 N/A INTRINSIC
low complexity region 454 467 N/A INTRINSIC
low complexity region 486 499 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATPase/helicase domain, and thus it belongs to the SWI/SNF family of chromatin remodeling proteins. This protein is found to undergo cell cycle-dependent phosphorylation, which regulates its nuclear matrix and chromatin association, and suggests its involvement in the gene regulation at interphase and chromosomal segregation in mitosis. Mutations in this gene are associated with an X-linked mental retardation (XLMR) syndrome most often accompanied by alpha-thalassemia (ATRX) syndrome. These mutations have been shown to cause diverse changes in the pattern of DNA methylation, which may provide a link between chromatin remodeling, DNA methylation, and gene expression in developmental processes. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a floxed allele activated in different tissues at different time points can serve as a model of alpha-thalassemia/mental retardation syndrome, nondeletion type, X-linked. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A930011G23Rik A G 5: 99,234,576 L271P probably benign Het
Adamts3 A C 5: 89,775,421 D175E probably benign Het
Adcy4 T C 14: 55,771,472 T833A probably benign Het
Adgrf5 A T 17: 43,440,067 I508F probably damaging Het
AI481877 A T 4: 59,099,383 V103D possibly damaging Het
Arhgap9 G T 10: 127,327,724 V464L probably damaging Het
Atp10a T A 7: 58,824,434 D1156E probably damaging Het
Atp2a1 A T 7: 126,450,142 M576K probably benign Het
Ccdc141 A C 2: 77,011,671 V1472G possibly damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Celsr1 G T 15: 86,032,685 N362K probably damaging Het
Cep290 G A 10: 100,516,196 A755T probably benign Het
Cfap70 T A 14: 20,394,999 E1076V probably damaging Het
Cps1 T C 1: 67,209,642 V1176A probably damaging Het
Csf2rb2 A C 15: 78,297,068 N41K probably damaging Het
Csn1s2a G A 5: 87,778,193 V43M probably damaging Het
Cyp26b1 T C 6: 84,584,272 D136G probably benign Het
Cyp7b1 A G 3: 18,097,452 L199P probably benign Het
Dapk1 C T 13: 60,719,654 T225I probably damaging Het
Dio2 T A 12: 90,729,906 T103S probably benign Het
Dnhd1 T A 7: 105,655,767 S339T probably benign Het
Drc1 A G 5: 30,366,497 N737D probably damaging Het
Efhc1 C T 1: 20,979,538 P541S probably benign Het
Elmo2 A T 2: 165,292,157 I637N probably damaging Het
Eps15 T A 4: 109,382,837 D492E probably damaging Het
Ermn G T 2: 58,048,237 N121K probably benign Het
F5 A G 1: 164,193,531 T1192A possibly damaging Het
Fam69a C A 5: 107,909,847 V237F probably damaging Het
Fbxo22 T C 9: 55,223,487 F347L probably benign Het
Fbxw15 G A 9: 109,558,246 S227F probably damaging Het
Foxj3 A G 4: 119,619,351 N242S probably benign Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Grm4 A G 17: 27,472,940 V235A probably damaging Het
Gstm4 T C 3: 108,043,558 N74S probably damaging Het
Gtf3c3 A G 1: 54,420,424 V393A possibly damaging Het
Hltf T A 3: 20,105,691 L702H probably damaging Het
Inpp4a T A 1: 37,392,978 V153E possibly damaging Het
Kmt5c T C 7: 4,742,730 probably null Het
Kynu A G 2: 43,604,157 R201G possibly damaging Het
Lrp2 T A 2: 69,503,530 T1456S probably benign Het
Lrrc40 G A 3: 158,036,804 V19I probably benign Het
M1ap T A 6: 83,005,510 C258* probably null Het
Man2a1 C T 17: 64,669,497 R427W probably damaging Het
Man2a1 T C 17: 64,752,457 L1113P probably benign Het
Meikin C A 11: 54,417,787 Q404K probably benign Het
Mfsd4a T C 1: 132,053,596 I222V possibly damaging Het
Mpp6 T A 6: 50,196,545 M463K probably damaging Het
N4bp2 A G 5: 65,806,825 N739S possibly damaging Het
Ncoa2 A T 1: 13,162,293 probably null Het
Nisch G T 14: 31,177,271 probably benign Het
Nmur2 A G 11: 56,029,621 V266A probably damaging Het
Npcd G A 15: 79,828,786 R147C probably damaging Het
Olfr209 T A 16: 59,361,880 I113F probably benign Het
Olfr735 T A 14: 50,346,080 M121L probably benign Het
Parp4 A T 14: 56,648,132 H1556L unknown Het
Pcdh9 G T 14: 93,888,671 A21E probably benign Het
Phtf1 A G 3: 103,996,642 E436G probably benign Het
Piezo2 C A 18: 63,032,840 probably null Het
Piezo2 T C 18: 63,108,087 Y690C probably damaging Het
Pla2g4f T C 2: 120,311,068 R183G possibly damaging Het
Plxnd1 T C 6: 115,994,057 D250G probably damaging Het
Ppig A G 2: 69,749,400 D426G unknown Het
Ppp3cb T C 14: 20,524,472 E185G possibly damaging Het
Qsox1 A T 1: 155,794,618 M151K probably null Het
Ralgapa2 T C 2: 146,342,728 E1453G probably benign Het
Rnf167 G A 11: 70,650,012 V191I probably benign Het
Rp1 T C 1: 4,348,832 K686E possibly damaging Het
Ryr1 T G 7: 29,067,621 Q2979P probably damaging Het
Scaf1 T A 7: 45,008,019 I479F probably damaging Het
Sept8 A G 11: 53,534,483 T68A probably benign Het
Sh3rf1 A T 8: 61,372,627 N552I probably damaging Het
Slc1a3 A G 15: 8,688,404 L68P probably damaging Het
Slc39a6 G A 18: 24,585,467 P511L probably benign Het
Slc9c1 A G 16: 45,554,289 Y339C probably damaging Het
Smarcal1 G T 1: 72,585,961 C89F probably damaging Het
Smu1 A T 4: 40,745,537 M261K probably damaging Het
Spag8 T G 4: 43,653,087 probably benign Het
Spag8 T C 4: 43,653,345 probably benign Het
Spata31d1a T C 13: 59,703,402 D304G probably benign Het
Spdl1 A T 11: 34,821,029 L298* probably null Het
Stac2 C T 11: 98,039,618 probably null Het
Stag1 A G 9: 100,953,462 probably null Het
Stpg2 C T 3: 139,419,781 P445L probably damaging Het
Sult2a8 A T 7: 14,423,526 V128E probably damaging Het
Synm A G 7: 67,735,959 F210L probably damaging Het
Tbck C G 3: 132,774,502 A714G probably benign Het
Tcerg1 A T 18: 42,560,947 Y711F possibly damaging Het
Tnfrsf25 A G 4: 152,117,008 T98A probably benign Het
Togaram2 T C 17: 71,691,455 S218P probably damaging Het
Tpp1 A T 7: 105,750,308 D84E probably benign Het
Trim30d G T 7: 104,483,475 Q202K probably damaging Het
Trim37 T A 11: 87,178,019 V397E probably damaging Het
Triml1 A T 8: 43,130,475 I363N probably damaging Het
Trpm6 T A 19: 18,891,999 probably null Het
Tsc2 T C 17: 24,604,408 S1055G probably benign Het
Ubr5 T C 15: 37,989,377 D2065G probably damaging Het
Uggt2 G T 14: 119,032,276 P948Q probably benign Het
Vps13c A T 9: 67,944,117 S2345C probably damaging Het
Wtap G T 17: 12,980,884 R48S possibly damaging Het
Zbtb38 A G 9: 96,688,881 V50A probably damaging Het
Zcchc2 T A 1: 106,030,287 S829R probably benign Het
Zfp385b T C 2: 77,415,972 D237G probably benign Het
Other mutations in Atrx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Atrx APN X 105823799 missense probably damaging 0.99
IGL01293:Atrx APN X 105876195 missense probably benign 0.02
IGL01383:Atrx APN X 105802075 missense probably damaging 0.98
IGL01701:Atrx APN X 105830920 missense probably damaging 1.00
IGL02252:Atrx APN X 105845823 missense possibly damaging 0.89
IGL02411:Atrx APN X 105830981 missense possibly damaging 0.82
IGL02929:Atrx APN X 105879906 splice site probably null
IGL03004:Atrx APN X 105832509 nonsense probably null
R2920:Atrx UTSW X 105830868 missense probably benign 0.22
R3928:Atrx UTSW X 105879917 missense possibly damaging 0.91
R3929:Atrx UTSW X 105879917 missense possibly damaging 0.91
X0028:Atrx UTSW X 105877412 missense probably damaging 0.99
X0060:Atrx UTSW X 105847687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCAGACACCCAACTTG -3'
(R):5'- GTTAAGGTTGCTATACCACCATTGC -3'

Sequencing Primer
(F):5'- CCTTGTAAGATCTGTAACAGCTGG -3'
(R):5'- GCTTCACCTACTAAGTGTCC -3'
Posted On2014-06-23