Incidental Mutation 'R1800:Col17a1'
ID203101
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Namecollagen, type XVII, alpha 1
SynonymsBP180, Bpag2, BPAg2, Bpag
MMRRC Submission 039830-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R1800 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location47646344-47692094 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47650862 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1081 (N1081K)
Ref Sequence ENSEMBL: ENSMUSP00000084141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026045
AA Change: N1081K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064
AA Change: N1081K

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000086923
AA Change: N1081K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064
AA Change: N1081K

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151102
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,066,718 K556R probably damaging Het
4933406P04Rik A T 10: 20,311,147 probably benign Het
A530099J19Rik T C 13: 19,729,679 noncoding transcript Het
Acmsd C A 1: 127,759,756 Y258* probably null Het
Adgrf5 A T 17: 43,451,082 I1223F probably damaging Het
Afp C T 5: 90,490,796 P6S probably benign Het
Agap2 C A 10: 127,091,671 H1120Q probably damaging Het
Angpt1 A G 15: 42,512,404 V152A probably damaging Het
Ankrd1 A T 19: 36,119,359 F23I probably damaging Het
Armc12 T C 17: 28,538,895 S334P possibly damaging Het
Arnt2 C A 7: 84,275,375 D415Y probably damaging Het
Cacna1s G T 1: 136,076,854 V131L probably benign Het
Cacna2d2 T C 9: 107,527,433 V1141A possibly damaging Het
Cfap61 T C 2: 146,042,622 L580P probably damaging Het
Chga A T 12: 102,555,905 S23C probably damaging Het
Chrna5 A G 9: 55,004,875 T320A probably damaging Het
Cox7b2 A T 5: 71,443,063 C51S possibly damaging Het
Cwc22 A T 2: 77,929,453 D83E possibly damaging Het
D130043K22Rik A C 13: 24,883,894 D871A probably damaging Het
Dab2 A T 15: 6,435,467 M361L probably benign Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnmbp A G 19: 43,901,720 I536T probably benign Het
Ehmt1 A T 2: 24,884,290 S43R probably damaging Het
Ercc5 T C 1: 44,173,380 L666P probably benign Het
F5 A G 1: 164,182,834 H378R probably damaging Het
Fam84a T C 12: 14,150,225 Y167C probably damaging Het
Fat2 A T 11: 55,283,892 N1998K probably damaging Het
Fbxo28 T C 1: 182,341,534 D13G unknown Het
Fras1 T C 5: 96,709,882 S2012P probably benign Het
Gm4758 T A 16: 36,312,533 D57E probably damaging Het
Gm5624 T A 14: 44,561,845 N41I probably damaging Het
Gm6768 A T 12: 119,261,771 noncoding transcript Het
Gm8104 A G 14: 43,101,571 I73V possibly damaging Het
Gpr68 G A 12: 100,878,908 P126S probably damaging Het
Gucy1a2 A T 9: 3,582,685 T156S possibly damaging Het
Hacl1 T A 14: 31,614,264 Y429F probably damaging Het
Haus3 A C 5: 34,163,572 L510R probably damaging Het
Helq C T 5: 100,774,124 G738D probably benign Het
Hsd3b2 G C 3: 98,712,237 P131A probably damaging Het
Il22ra1 G T 4: 135,748,160 C247F probably benign Het
Ivl T C 3: 92,572,584 E58G unknown Het
Kcnk9 G T 15: 72,546,099 Q61K probably benign Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Loxhd1 G T 18: 77,402,502 A1314S probably damaging Het
Lrba A G 3: 86,351,868 I1397V probably benign Het
Lrig3 T A 10: 125,997,051 probably null Het
Lrrc36 A G 8: 105,449,765 D378G probably damaging Het
Lrrc49 G A 9: 60,598,191 T527I probably damaging Het
Map4k4 C A 1: 40,023,460 T1195K probably damaging Het
Mrps33 G A 6: 39,802,495 R89C probably damaging Het
Mtor T C 4: 148,462,892 V444A probably benign Het
Myh2 A G 11: 67,188,938 E1046G probably damaging Het
Myo15b G T 11: 115,880,509 probably null Het
Myo5c T C 9: 75,246,164 Y111H probably damaging Het
Ndufv2 G C 17: 66,083,486 T163R probably damaging Het
Nf1 A G 11: 79,553,968 N373S possibly damaging Het
Nwd2 A G 5: 63,805,574 M834V probably benign Het
Ogfod2 T C 5: 124,114,956 V343A probably damaging Het
Olfr1220 T A 2: 89,097,706 T74S probably benign Het
Olfr401 A T 11: 74,121,408 T40S probably benign Het
Olfr597 T A 7: 103,320,414 M1K probably null Het
Olfr610 T C 7: 103,506,041 I302V possibly damaging Het
Olfr736 C A 14: 50,393,329 S191* probably null Het
Olfr744 C T 14: 50,618,686 L155F probably benign Het
Olfr954 A T 9: 39,462,114 I228F probably damaging Het
Parp1 T A 1: 180,600,526 probably null Het
Ppp3ca A T 3: 136,935,031 I448F probably damaging Het
Prss44 T C 9: 110,817,204 V333A probably damaging Het
Pxk C T 14: 8,151,507 R441* probably null Het
Rars A C 11: 35,825,995 D231E probably benign Het
Rfc1 T C 5: 65,264,379 Y1059C probably damaging Het
Rilpl1 T A 5: 124,514,656 I2F probably damaging Het
Sarm1 G T 11: 78,490,994 A221E possibly damaging Het
Serpina3f A G 12: 104,217,406 T176A probably damaging Het
Slc22a20 T C 19: 5,985,667 E131G probably benign Het
Slc26a11 T C 11: 119,373,153 V343A probably damaging Het
Slc2a4 A G 11: 69,946,307 I9T probably benign Het
Slc39a6 G T 18: 24,585,202 D599E probably damaging Het
Slc5a6 G T 5: 31,040,676 S285* probably null Het
Spata9 A G 13: 75,977,641 H81R probably benign Het
St7l A G 3: 104,919,496 E436G probably damaging Het
Tecrl A G 5: 83,279,230 I357T probably damaging Het
Thop1 C T 10: 81,073,209 R25C probably damaging Het
Tmprss12 A G 15: 100,292,547 E266G probably benign Het
Tpgs1 T A 10: 79,675,510 V162D possibly damaging Het
Trpa1 C T 1: 14,874,424 R1032Q probably benign Het
Tspan12 A G 6: 21,795,700 Y164H probably damaging Het
Ubr4 T C 4: 139,407,963 Y869H probably damaging Het
Vmn1r21 A G 6: 57,843,814 I215T probably benign Het
Zan A T 5: 137,386,451 S5104T unknown Het
Zfp318 T C 17: 46,412,054 V1661A probably benign Het
Zfp365 C T 10: 67,888,942 R372K probably damaging Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47681403 missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47668539 missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47668632 missense probably benign 0.01
IGL02176:Col17a1 APN 19 47651219 missense probably benign 0.02
IGL03352:Col17a1 APN 19 47681375 splice site probably null
IGL03409:Col17a1 APN 19 47666540 missense possibly damaging 0.79
scabby UTSW 19 47680408 nonsense probably null
IGL03050:Col17a1 UTSW 19 47648098 critical splice donor site probably null
R0309:Col17a1 UTSW 19 47671362 splice site probably benign
R0316:Col17a1 UTSW 19 47685533 critical splice donor site probably null
R0330:Col17a1 UTSW 19 47670432 missense probably benign 0.27
R0391:Col17a1 UTSW 19 47663824 missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47665878 missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47669433 missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47648910 unclassified probably benign
R1585:Col17a1 UTSW 19 47650837 missense probably benign 0.00
R1710:Col17a1 UTSW 19 47670931 missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47649003 unclassified probably benign
R2007:Col17a1 UTSW 19 47667702 missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47650746 missense probably benign 0.02
R2258:Col17a1 UTSW 19 47681377 critical splice donor site probably null
R2268:Col17a1 UTSW 19 47650111 missense probably benign 0.00
R3608:Col17a1 UTSW 19 47680405 missense probably benign 0.00
R4380:Col17a1 UTSW 19 47657090 missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47663058 critical splice acceptor site probably null
R4928:Col17a1 UTSW 19 47670458 splice site probably null
R5058:Col17a1 UTSW 19 47685550 nonsense probably null
R5407:Col17a1 UTSW 19 47666507 missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47662390 missense probably damaging 1.00
R5572:Col17a1 UTSW 19 47650729 missense probably benign 0.44
R5889:Col17a1 UTSW 19 47649072 missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47654220 missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47680420 missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47653379 missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47680408 nonsense probably null
R6484:Col17a1 UTSW 19 47670429 missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47650721 splice site probably null
Z1088:Col17a1 UTSW 19 47652178 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGATGCCCTGGTCTTTACTC -3'
(R):5'- TCATCACTTGGAGGGCATGTG -3'

Sequencing Primer
(F):5'- TCCTGATCACTCACTTGACATATAG -3'
(R):5'- CCTTGTGTGCTGAGTCACAAACG -3'
Posted On2014-06-23