Incidental Mutation 'R1801:Myrf'
ID203183
Institutional Source Beutler Lab
Gene Symbol Myrf
Ensembl Gene ENSMUSG00000036098
Gene Namemyelin regulatory factor
SynonymsGm98, LOC386531, LOC225908
MMRRC Submission 039831-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.756) question?
Stock #R1801 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location10208272-10240748 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 10214191 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 928 (V928L)
Ref Sequence ENSEMBL: ENSMUSP00000139601 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088013] [ENSMUST00000186056] [ENSMUST00000189897]
Predicted Effect probably benign
Transcript: ENSMUST00000088013
AA Change: V954L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000085329
Gene: ENSMUSG00000036098
AA Change: V954L

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 5.3e-16 PFAM
Pfam:MRF_C1 667 702 8.3e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 977 1111 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186056
AA Change: V753L

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000140871
Gene: ENSMUSG00000036098
AA Change: V753L

DomainStartEndE-ValueType
low complexity region 83 104 N/A INTRINSIC
low complexity region 118 144 N/A INTRINSIC
Pfam:NDT80_PhoG 191 338 6.9e-28 PFAM
Pfam:Peptidase_S74 385 445 1.2e-12 PFAM
Pfam:MRF_C1 465 500 1.4e-23 PFAM
low complexity region 571 582 N/A INTRINSIC
low complexity region 672 709 N/A INTRINSIC
Pfam:MRF_C2 801 936 7e-52 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000186854
AA Change: V292L
Predicted Effect probably benign
Transcript: ENSMUST00000189897
AA Change: V928L

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139601
Gene: ENSMUSG00000036098
AA Change: V928L

DomainStartEndE-ValueType
low complexity region 67 99 N/A INTRINSIC
low complexity region 177 199 N/A INTRINSIC
low complexity region 228 244 N/A INTRINSIC
low complexity region 285 306 N/A INTRINSIC
low complexity region 320 346 N/A INTRINSIC
Pfam:NDT80_PhoG 393 540 7.6e-31 PFAM
Pfam:Peptidase_S74 587 647 1.1e-15 PFAM
Pfam:MRF_C1 667 702 1.1e-26 PFAM
low complexity region 773 784 N/A INTRINSIC
low complexity region 847 884 N/A INTRINSIC
Pfam:MRF_C2 976 1111 5.5e-55 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190922
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor that is required for central nervous system myelination and may regulate oligodendrocyte differentiation. It is thought to act by increasing the expression of genes that effect myelin production but may also directly promote myelin gene expression. Loss of a similar gene in mouse models results in severe demyelination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,067,396 E362G probably damaging Het
Abcc5 T C 16: 20,338,887 M1307V probably benign Het
Adamts9 A G 6: 92,863,376 V1142A probably benign Het
Ano10 T C 9: 122,253,030 N525S probably damaging Het
Bpifa2 T C 2: 154,011,504 probably null Het
C7 C T 15: 5,012,021 V468I possibly damaging Het
Carf A T 1: 60,141,505 H362L possibly damaging Het
Ccdc171 A C 4: 83,546,895 I37L probably benign Het
Ccdc182 T C 11: 88,294,190 L32P possibly damaging Het
Celsr3 A T 9: 108,834,626 D1678V possibly damaging Het
Col7a1 A T 9: 108,960,997 Y920F unknown Het
Cpsf3 T C 12: 21,313,790 V627A probably benign Het
D7Ertd443e A G 7: 134,270,212 M640T probably damaging Het
Ddi2 T C 4: 141,683,972 D543G probably damaging Het
Dnah9 T C 11: 65,955,297 N2972D probably damaging Het
Dnajc18 T C 18: 35,680,804 D304G probably damaging Het
Epg5 T C 18: 77,983,490 V1232A possibly damaging Het
Ezr T C 17: 6,742,372 T358A possibly damaging Het
Filip1 A G 9: 79,815,846 S1164P probably damaging Het
Gm14085 C T 2: 122,521,652 R324C possibly damaging Het
Gm5346 A T 8: 43,625,917 C423* probably null Het
Gmip T C 8: 69,814,477 V341A probably benign Het
Gnb3 A C 6: 124,835,636 F286V probably benign Het
Gpatch2 T A 1: 187,225,831 S128T probably benign Het
Gpr87 T C 3: 59,179,392 R231G possibly damaging Het
Hip1r G A 5: 123,998,808 R613Q probably benign Het
Hsd3b7 T C 7: 127,803,034 Y284H possibly damaging Het
Il1rap A T 16: 26,698,875 D275V probably damaging Het
Il4 G T 11: 53,618,538 H23Q possibly damaging Het
Kit A G 5: 75,648,393 Y749C probably damaging Het
Klb A G 5: 65,349,235 K275R probably null Het
Klhl12 G T 1: 134,489,070 R510L probably damaging Het
Lrrc8b A G 5: 105,480,823 Y345C probably damaging Het
Med15 T C 16: 17,680,735 T98A possibly damaging Het
Mmp1a T A 9: 7,475,390 Y387N probably damaging Het
Nr1d1 T C 11: 98,771,499 K134E probably damaging Het
Nrxn3 A T 12: 90,283,582 D305V probably damaging Het
Obscn A C 11: 58,998,321 S7542A unknown Het
Olfr1197 T A 2: 88,729,264 I112F probably damaging Het
Pak4 G A 7: 28,565,190 R96C probably damaging Het
Papd5 T G 8: 88,250,788 V406G probably benign Het
Pde6b A T 5: 108,427,847 D691V possibly damaging Het
Pdss2 A G 10: 43,345,605 E171G probably benign Het
Pdzd2 C T 15: 12,387,654 V873I possibly damaging Het
Plb1 A T 5: 32,293,243 D376V probably damaging Het
Plekhg1 T C 10: 3,963,904 Y1209H probably damaging Het
Prickle2 A G 6: 92,416,904 C263R probably damaging Het
Psma2 A T 13: 14,623,605 Y104F probably benign Het
Ptger4 T A 15: 5,242,800 M113L possibly damaging Het
Rgs10 T G 7: 128,404,477 D17A possibly damaging Het
Rpap3 A G 15: 97,694,209 S189P possibly damaging Het
Rsbn1 T C 3: 103,914,872 L102P probably damaging Het
Ryr2 T C 13: 11,595,281 S655G probably benign Het
Samd4b A T 7: 28,407,331 probably null Het
Sema4a C T 3: 88,436,749 D732N probably benign Het
Sh3bp5l A G 11: 58,346,351 D378G probably benign Het
Sh3gl3 C T 7: 82,284,119 T230I possibly damaging Het
Slc5a1 A T 5: 33,146,953 Q299L probably damaging Het
Ssc5d C A 7: 4,936,607 H681N probably benign Het
Sugp2 T C 8: 70,236,710 S10P possibly damaging Het
Supt5 A G 7: 28,317,214 probably null Het
Syna A G 5: 134,560,089 V2A probably benign Het
Tcp1 T A 17: 12,922,202 Y299* probably null Het
Tenm3 C A 8: 48,276,256 V1572L probably benign Het
Trp53rka A G 2: 165,491,613 S119P probably damaging Het
Ubr4 T A 4: 139,452,563 probably null Het
Uchl4 T A 9: 64,235,475 D79E probably benign Het
Vmn2r17 C A 5: 109,428,478 T405K probably damaging Het
Xpnpep1 A G 19: 53,010,133 L228P probably damaging Het
Xrcc4 T G 13: 89,992,579 E170D probably damaging Het
Zfp945 T C 17: 22,851,762 T388A probably damaging Het
Zfp947 G A 17: 22,146,462 A77V probably benign Het
Zkscan5 G A 5: 145,220,205 G433R probably damaging Het
Other mutations in Myrf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Myrf APN 19 10224513 missense probably benign 0.30
IGL01132:Myrf APN 19 10223205 missense probably damaging 1.00
IGL01958:Myrf APN 19 10210378 unclassified probably benign
IGL02154:Myrf APN 19 10216118 missense probably damaging 0.98
IGL02370:Myrf APN 19 10214140 missense probably benign
IGL02584:Myrf APN 19 10212223 splice site probably benign
IGL02817:Myrf APN 19 10225452 missense probably benign 0.45
R0312:Myrf UTSW 19 10218162 missense probably benign 0.00
R0367:Myrf UTSW 19 10218162 missense probably benign 0.00
R0389:Myrf UTSW 19 10218162 missense probably benign 0.00
R0416:Myrf UTSW 19 10215812 critical splice acceptor site probably null
R0446:Myrf UTSW 19 10218162 missense probably benign 0.00
R0464:Myrf UTSW 19 10218162 missense probably benign 0.00
R0465:Myrf UTSW 19 10218162 missense probably benign 0.00
R0487:Myrf UTSW 19 10218162 missense probably benign 0.00
R0533:Myrf UTSW 19 10218162 missense probably benign 0.00
R0534:Myrf UTSW 19 10218162 missense probably benign 0.00
R0570:Myrf UTSW 19 10211797 missense probably damaging 1.00
R0622:Myrf UTSW 19 10223452 missense probably damaging 0.99
R0631:Myrf UTSW 19 10228882 missense probably benign 0.00
R0721:Myrf UTSW 19 10216080 missense probably damaging 1.00
R0848:Myrf UTSW 19 10218162 missense probably benign 0.00
R1056:Myrf UTSW 19 10223486 missense probably benign 0.11
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1574:Myrf UTSW 19 10225487 missense probably damaging 1.00
R1897:Myrf UTSW 19 10218232 missense probably benign 0.05
R1950:Myrf UTSW 19 10218190 missense possibly damaging 0.93
R1957:Myrf UTSW 19 10219796 missense probably benign 0.04
R2089:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2091:Myrf UTSW 19 10224600 missense possibly damaging 0.48
R2139:Myrf UTSW 19 10216467 missense probably damaging 0.98
R2144:Myrf UTSW 19 10228674 missense probably benign 0.05
R3932:Myrf UTSW 19 10218151 missense probably damaging 1.00
R3964:Myrf UTSW 19 10219615 missense probably benign 0.03
R3966:Myrf UTSW 19 10219615 missense probably benign 0.03
R3970:Myrf UTSW 19 10223237 missense probably damaging 1.00
R4607:Myrf UTSW 19 10229067 missense probably damaging 1.00
R4746:Myrf UTSW 19 10218591 missense probably damaging 0.99
R5117:Myrf UTSW 19 10212493 missense probably damaging 1.00
R5598:Myrf UTSW 19 10215290 missense probably benign 0.00
R5719:Myrf UTSW 19 10216723 missense probably damaging 1.00
R5841:Myrf UTSW 19 10223547 missense probably null 1.00
R5994:Myrf UTSW 19 10219117 missense probably null 1.00
R6148:Myrf UTSW 19 10212475 missense probably damaging 0.99
R6229:Myrf UTSW 19 10219798 missense probably benign 0.19
R6477:Myrf UTSW 19 10228785 missense probably benign 0.41
R6623:Myrf UTSW 19 10223359 missense probably benign 0.13
R6878:Myrf UTSW 19 10216478 missense possibly damaging 0.80
R6932:Myrf UTSW 19 10219560 missense probably damaging 1.00
R7127:Myrf UTSW 19 10215341 missense probably benign 0.01
X0028:Myrf UTSW 19 10212158 missense probably damaging 1.00
Z1088:Myrf UTSW 19 10221298 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATTCTGTGCCCAGGAAGC -3'
(R):5'- ATGAAGGCTCACAGAAGTCC -3'

Sequencing Primer
(F):5'- CCATGTGACCGGGCTGAAATG -3'
(R):5'- GCTCACAGAAGTCCGGGAC -3'
Posted On2014-06-23