Incidental Mutation 'R1802:Plekhm2'
ID203201
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission 039832-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1802 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 141634347 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 262 (S262T)
Ref Sequence ENSEMBL: ENSMUSP00000030751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000084203]
Predicted Effect probably benign
Transcript: ENSMUST00000030751
AA Change: S262T

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: S262T

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000084203
AA Change: S282T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: S282T

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik T A 11: 101,988,476 Y25N possibly damaging Het
Abcd2 G T 15: 91,163,102 R583S probably benign Het
Ago2 A T 15: 73,121,180 F492Y probably damaging Het
Ano4 T A 10: 88,981,016 D610V probably damaging Het
Atp6v0d2 A G 4: 19,922,366 probably null Het
Atxn7 T G 14: 14,089,419 S312A probably benign Het
Azgp1 A G 5: 137,985,231 Y56C probably damaging Het
Bcan A G 3: 87,993,108 V606A possibly damaging Het
Btnl9 T A 11: 49,175,790 I335F probably benign Het
Ccdc63 T C 5: 122,129,877 R9G probably damaging Het
Cdyl T A 13: 35,872,636 L534* probably null Het
Celf2 T C 2: 6,549,933 E445G probably damaging Het
Cnot8 T C 11: 58,117,535 C276R probably benign Het
Dock4 A G 12: 40,794,598 I1135V possibly damaging Het
Edc3 A G 9: 57,727,315 D205G probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Fancl T G 11: 26,459,709 S188R probably benign Het
Fbn2 T A 18: 58,052,976 K1767* probably null Het
Glrb A T 3: 80,861,957 H154Q probably damaging Het
Gm19965 C T 1: 116,820,903 R105* probably null Het
Grhpr C A 4: 44,988,950 Y202* probably null Het
Herc2 A G 7: 56,184,332 E3095G probably damaging Het
Il22ra2 A T 10: 19,626,699 N89Y probably damaging Het
Itgb6 T C 2: 60,653,281 D261G probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kif1a T A 1: 93,066,149 I360F probably damaging Het
Kmt2d T C 15: 98,862,985 Q828R unknown Het
March10 C A 11: 105,389,915 A515S probably benign Het
Mios T A 6: 8,216,385 Y436* probably null Het
Mprip C T 11: 59,755,041 L684F probably damaging Het
Mybpc2 T A 7: 44,512,470 N519Y possibly damaging Het
Naga C T 15: 82,337,468 R24Q probably benign Het
Nr2c1 G A 10: 94,163,786 V103M possibly damaging Het
Oca2 A G 7: 56,254,980 S65G possibly damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr598 A G 7: 103,328,647 I54V probably benign Het
Phyhipl A T 10: 70,599,025 I28N probably benign Het
Pifo T A 3: 106,014,550 Q19L possibly damaging Het
Pik3cb C A 9: 99,101,289 E89* probably null Het
Ppm1a T A 12: 72,793,707 probably null Het
Relt T C 7: 100,850,194 I173V probably damaging Het
Rfx7 T A 9: 72,619,637 S1370T possibly damaging Het
Rps7 G A 12: 28,634,259 R81C probably benign Het
Saa3 T C 7: 46,712,126 *123W probably null Het
Serpina3b C A 12: 104,138,637 H357Q probably damaging Het
Slc9c1 T A 16: 45,558,281 N493K probably benign Het
Spata31 T C 13: 64,922,383 Y782H probably benign Het
Tfap2a T C 13: 40,725,170 D166G probably damaging Het
Thada A T 17: 84,464,407 M9K probably benign Het
Tmem269 A T 4: 119,210,873 probably null Het
Tnxb C A 17: 34,703,889 P2482Q probably damaging Het
Vit T C 17: 78,605,511 V291A possibly damaging Het
Zfp930 G T 8: 69,226,394 A18S possibly damaging Het
Zufsp A T 10: 33,943,718 V200D probably damaging Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1475:Plekhm2 UTSW 4 141627854 missense possibly damaging 0.75
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCAGAGACATCTCCTGC -3'
(R):5'- AGATAAGGCATTCTTTGGGGTCC -3'

Sequencing Primer
(F):5'- AGAGACATCTCCTGCCCTTGG -3'
(R):5'- CATTCTTTGGGGTCCAGCTG -3'
Posted On2014-06-23