Incidental Mutation 'R1803:Dnpep'
ID203253
Institutional Source Beutler Lab
Gene Symbol Dnpep
Ensembl Gene ENSMUSG00000026209
Gene Nameaspartyl aminopeptidase
Synonyms
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75307896-75317990 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 75309414 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 419 (L419*)
Ref Sequence ENSEMBL: ENSMUSP00000139739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066668] [ENSMUST00000113605] [ENSMUST00000185419] [ENSMUST00000185797] [ENSMUST00000187000] [ENSMUST00000187836] [ENSMUST00000189551]
Predicted Effect probably null
Transcript: ENSMUST00000066668
AA Change: L419*
SMART Domains Protein: ENSMUSP00000070821
Gene: ENSMUSG00000026209
AA Change: L419*

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 2.9e-199 PFAM
Pfam:Peptidase_M42 328 455 1.2e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113605
AA Change: L419*
SMART Domains Protein: ENSMUSP00000109235
Gene: ENSMUSG00000026209
AA Change: L419*

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185419
AA Change: L419*
SMART Domains Protein: ENSMUSP00000140035
Gene: ENSMUSG00000026209
AA Change: L419*

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 459 7.3e-192 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000185797
AA Change: L421*
SMART Domains Protein: ENSMUSP00000140864
Gene: ENSMUSG00000026209
AA Change: L421*

DomainStartEndE-ValueType
Pfam:Peptidase_M18 24 462 2e-190 PFAM
Pfam:Peptidase_M42 330 457 1.9e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186278
Predicted Effect probably benign
Transcript: ENSMUST00000187000
SMART Domains Protein: ENSMUSP00000141014
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 271 2.9e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187791
Predicted Effect probably null
Transcript: ENSMUST00000187836
AA Change: L419*
SMART Domains Protein: ENSMUSP00000139739
Gene: ENSMUSG00000026209
AA Change: L419*

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 460 9.4e-194 PFAM
Pfam:Peptidase_M42 328 455 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189551
SMART Domains Protein: ENSMUSP00000140563
Gene: ENSMUSG00000026209

DomainStartEndE-ValueType
Pfam:Peptidase_M18 22 198 6.4e-75 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an aminopeptidase which prefers acidic amino acids, and specifically favors aspartic acid over glutamic acid. It is thought to be a cytosolic protein involved in general metabolism of intracellular proteins. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Dnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02419:Dnpep APN 1 75315688 missense probably damaging 1.00
P0026:Dnpep UTSW 1 75308685 missense probably benign 0.01
R0126:Dnpep UTSW 1 75312538 nonsense probably null
R0318:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R0669:Dnpep UTSW 1 75311778 unclassified probably benign
R1076:Dnpep UTSW 1 75315938 unclassified probably benign
R1478:Dnpep UTSW 1 75316027 missense probably damaging 1.00
R3409:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R3411:Dnpep UTSW 1 75316626 missense probably damaging 1.00
R4590:Dnpep UTSW 1 75316401 missense probably damaging 1.00
R4863:Dnpep UTSW 1 75309230 intron probably benign
R4948:Dnpep UTSW 1 75316760 missense probably benign 0.13
R5873:Dnpep UTSW 1 75315143 missense probably damaging 1.00
R5891:Dnpep UTSW 1 75311812 missense probably benign
R5907:Dnpep UTSW 1 75311991 critical splice donor site probably null
R6143:Dnpep UTSW 1 75315228 missense probably damaging 1.00
R6432:Dnpep UTSW 1 75315378 missense probably benign 0.12
R6433:Dnpep UTSW 1 75315378 missense probably benign 0.12
R7188:Dnpep UTSW 1 75316057 missense probably damaging 1.00
R7189:Dnpep UTSW 1 75313430 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTAGTCCACAGCAATCAGC -3'
(R):5'- GCTCCATATTAGGACTTCCTTGG -3'

Sequencing Primer
(F):5'- AGAACTCCAGTGGTACAG -3'
(R):5'- GGGCTTCATTTATACTAGGCAAGCC -3'
Posted On2014-06-23