Incidental Mutation 'R0092:Olfr119'
Institutional Source Beutler Lab
Gene Symbol Olfr119
Ensembl Gene ENSMUSG00000059964
Gene Nameolfactory receptor 119
SynonymsMOR263-7, GA_x6K02T2PSCP-2159633-2160598
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.033) question?
Stock #R0092 (G1)
Quality Score225
Status Validated
Chromosomal Location37696564-37702124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 37700805 bp
Amino Acid Change Leucine to Arginine at position 45 (L45R)
Ref Sequence ENSEMBL: ENSMUSP00000150099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080483] [ENSMUST00000213732]
Predicted Effect probably damaging
Transcript: ENSMUST00000080483
AA Change: L45R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092919
Gene: ENSMUSG00000059964
AA Change: L45R

Pfam:7tm_4 37 314 5.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 41 311 1.7e-5 PFAM
Pfam:7tm_1 47 296 3.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213732
AA Change: L45R

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.0292 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Sh3gl1 G T 17: 56,018,088 R250S probably benign Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Olfr119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02209:Olfr119 APN 17 37700992 missense probably damaging 1.00
IGL03339:Olfr119 APN 17 37700791 missense probably damaging 0.99
R0207:Olfr119 UTSW 17 37701058 nonsense probably null
R0378:Olfr119 UTSW 17 37701041 missense probably damaging 1.00
R0408:Olfr119 UTSW 17 37701299 missense probably benign
R0483:Olfr119 UTSW 17 37701297 missense probably benign 0.01
R1595:Olfr119 UTSW 17 37701113 missense probably benign 0.03
R1901:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R1902:Olfr119 UTSW 17 37701421 missense probably damaging 1.00
R2845:Olfr119 UTSW 17 37700823 missense probably damaging 1.00
R2846:Olfr119 UTSW 17 37700823 missense probably damaging 1.00
R4356:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R4381:Olfr119 UTSW 17 37700899 missense probably damaging 0.97
R6744:Olfr119 UTSW 17 37701445 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- aagggtatgaaaggcaaaagaag -3'
Posted On2013-04-11