Incidental Mutation 'R0092:Sh3gl1'
ID20332
Institutional Source Beutler Lab
Gene Symbol Sh3gl1
Ensembl Gene ENSMUSG00000003200
Gene NameSH3-domain GRB2-like 1
SynonymsSh3d2b, SH3P8, endophilin II, EEN
MMRRC Submission 038379-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.485) question?
Stock #R0092 (G1)
Quality Score225
Status Validated (trace)
Chromosome17
Chromosomal Location56016753-56036637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 56018088 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 250 (R250S)
Ref Sequence ENSEMBL: ENSMUSP00000003268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003268] [ENSMUST00000149441] [ENSMUST00000159996] [ENSMUST00000162883]
Predicted Effect probably benign
Transcript: ENSMUST00000003268
AA Change: R250S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000003268
Gene: ENSMUSG00000003200
AA Change: R250S

DomainStartEndE-ValueType
BAR 5 242 1.05e-98 SMART
low complexity region 250 264 N/A INTRINSIC
SH3 309 364 7.62e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131218
Predicted Effect probably benign
Transcript: ENSMUST00000149441
SMART Domains Protein: ENSMUSP00000119745
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153197
SMART Domains Protein: ENSMUSP00000125535
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 30 43 N/A INTRINSIC
Pfam:JAB 112 243 6.1e-11 PFAM
Pfam:Prok-JAB 125 258 1.2e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159340
SMART Domains Protein: ENSMUSP00000125555
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 10 27 N/A INTRINSIC
low complexity region 29 68 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
Blast:JAB_MPN 257 350 3e-55 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159420
Predicted Effect probably benign
Transcript: ENSMUST00000159996
SMART Domains Protein: ENSMUSP00000124644
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
JAB_MPN 260 382 1.35e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162883
SMART Domains Protein: ENSMUSP00000124128
Gene: ENSMUSG00000003199

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
low complexity region 32 71 N/A INTRINSIC
low complexity region 172 185 N/A INTRINSIC
Pfam:Prok-JAB 230 340 1.6e-8 PFAM
Pfam:JAB 236 311 1.7e-9 PFAM
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 95.1%
  • 20x: 88.6%
Validation Efficiency 99% (112/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the endophilin family of Src homology 3 domain-containing proteins. The encoded protein is involved in endocytosis and may also play a role in the cell cycle. Overexpression of this gene may play a role in leukemogenesis, and the encoded protein has been implicated in acute myeloid leukemia as a fusion partner of the myeloid-lymphoid leukemia protein. Pseudogenes of this gene are located on the long arm of chromosomes 11 and 17. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal life span and no obvious phenotypic defects. Mice homozygous for knock-out alleles of Sh3gl1-3 exhibit neonatal lethality, respiratory distress, absence of gastric milk, abnormal synaptic transmissionand abnormal synaptic vesicle recycling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A G 3: 37,028,159 D3790G probably benign Het
Abcg2 T A 6: 58,685,777 S535T probably benign Het
Acad11 A T 9: 104,090,341 probably benign Het
Acadm A T 3: 153,941,875 probably benign Het
Acot12 T A 13: 91,741,565 M12K probably damaging Het
Actr2 A T 11: 20,094,308 N99K probably benign Het
Adam2 G A 14: 66,053,887 A314V probably damaging Het
Aes G A 10: 81,561,220 G10D possibly damaging Het
Agl C T 3: 116,793,804 R34Q probably damaging Het
Agrn C T 4: 156,178,953 R338H probably damaging Het
AI661453 A G 17: 47,467,515 probably benign Het
Alpk3 A G 7: 81,092,553 D706G probably benign Het
Apbb1 T C 7: 105,559,154 E648G probably damaging Het
Astn2 C A 4: 66,403,982 A127S unknown Het
Asxl2 T C 12: 3,496,313 S366P probably benign Het
Bdh1 A T 16: 31,447,562 K92* probably null Het
Cacna1g C T 11: 94,457,264 S666N probably damaging Het
Ces2b A G 8: 104,836,512 T361A possibly damaging Het
Col6a4 T A 9: 106,013,314 E1927V probably benign Het
Ctnnb1 T G 9: 120,952,863 I314S possibly damaging Het
Cyp2c66 T C 19: 39,183,780 probably benign Het
Dennd4c T A 4: 86,781,607 F232I probably damaging Het
Dennd5a T C 7: 109,899,806 N950S possibly damaging Het
Dhx30 T C 9: 110,085,010 N14S possibly damaging Het
Dip2b T A 15: 100,202,265 V1004D probably damaging Het
Dnah1 A C 14: 31,271,609 S2872A probably benign Het
Dnajc10 T C 2: 80,325,682 V233A probably damaging Het
E230025N22Rik A G 18: 36,689,224 L162P probably damaging Het
Elmod3 T C 6: 72,566,809 D333G probably benign Het
Epb41l3 T A 17: 69,286,750 M846K probably damaging Het
Frem2 A G 3: 53,589,796 Y1766H probably benign Het
Fxr2 T C 11: 69,642,146 probably benign Het
Gm14085 G T 2: 122,517,597 probably benign Het
Gm9833 G A 3: 10,088,573 C134Y possibly damaging Het
Gmpr2 A G 14: 55,677,945 R258G probably benign Het
Helb T C 10: 120,089,808 Y888C probably damaging Het
Hephl1 TTCCAGATGTCC TTCC 9: 15,090,603 probably null Het
Hipk2 T C 6: 38,743,229 D482G probably damaging Het
Itgb4 G T 11: 115,979,124 R44L probably damaging Het
Itih1 T C 14: 30,940,863 probably benign Het
Kit T A 5: 75,647,754 S719R possibly damaging Het
Krt13 G A 11: 100,121,432 Q22* probably null Het
L3mbtl4 A C 17: 68,425,703 R59S probably benign Het
Lpp A G 16: 24,761,602 S23G probably benign Het
Magi3 G A 3: 104,050,964 Q602* probably null Het
Man2a1 A G 17: 64,659,084 probably benign Het
Muc5ac A G 7: 141,818,630 E2667G possibly damaging Het
Myo15b C G 11: 115,862,986 S842C possibly damaging Het
Naf1 T A 8: 66,889,108 S462T probably benign Het
Necab3 T C 2: 154,558,739 D34G possibly damaging Het
Nisch C A 14: 31,191,453 probably benign Het
Nlrc5 T C 8: 94,489,594 probably benign Het
Nmt1 T C 11: 103,046,493 F119L probably damaging Het
Nod1 T G 6: 54,944,541 D264A probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nt5e T A 9: 88,370,285 F567I probably benign Het
Obscn A T 11: 59,051,247 M4434K possibly damaging Het
Olfr119 T G 17: 37,700,805 L45R probably damaging Het
Olfr50 A G 2: 36,793,496 T87A probably benign Het
Olfr512 T C 7: 108,713,824 V145A probably benign Het
Olfr632 T C 7: 103,937,727 S116P probably damaging Het
Olfr796 A G 10: 129,608,221 S87P probably damaging Het
Opa1 A T 16: 29,625,594 D866V probably damaging Het
Otop1 T A 5: 38,299,830 V311E probably damaging Het
Pcsk2 A G 2: 143,801,024 D407G probably damaging Het
Pdcd1 A G 1: 94,052,424 W23R possibly damaging Het
Pigp A G 16: 94,365,462 V129A probably damaging Het
Pik3r5 A G 11: 68,492,803 R483G probably benign Het
Pink1 A G 4: 138,319,998 V225A probably benign Het
Plcl1 C G 1: 55,696,765 Q422E probably damaging Het
Plec T C 15: 76,183,743 E1222G probably benign Het
Polr1a T C 6: 71,967,455 probably benign Het
Prokr2 C T 2: 132,373,597 V154M probably damaging Het
Rasgrp4 A G 7: 29,145,132 R280G possibly damaging Het
Rmnd5b T C 11: 51,629,592 E8G possibly damaging Het
Sbf2 T A 7: 110,320,806 probably benign Het
Sec23b A G 2: 144,566,910 M172V probably benign Het
Setx T C 2: 29,146,293 V930A probably benign Het
Sft2d2 G A 1: 165,179,260 A159V possibly damaging Het
Skor1 C A 9: 63,145,995 D231Y probably damaging Het
Slc24a1 T G 9: 64,948,752 E291A unknown Het
Smc1b A T 15: 85,067,724 probably benign Het
Tbccd1 A T 16: 22,826,094 N177K possibly damaging Het
Tdp1 T A 12: 99,954,989 Y595N probably damaging Het
Tmem108 T C 9: 103,489,305 K496E possibly damaging Het
Tmprss7 T C 16: 45,667,596 D490G probably damaging Het
Tnrc6b A T 15: 80,918,528 N1511Y probably damaging Het
Top2b G A 14: 16,409,263 R802Q probably damaging Het
Trip10 A T 17: 57,250,798 K27N possibly damaging Het
Txlnb A G 10: 17,842,755 N445D possibly damaging Het
Txnrd1 T A 10: 82,879,802 I159N probably damaging Het
Ulk1 C A 5: 110,796,327 A164S probably null Het
Vmn2r83 T C 10: 79,491,964 V802A probably damaging Het
Zbtb4 A G 11: 69,779,351 I967V probably benign Het
Other mutations in Sh3gl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01784:Sh3gl1 APN 17 56019325 missense possibly damaging 0.48
IGL02721:Sh3gl1 APN 17 56017577 missense possibly damaging 0.91
R0525:Sh3gl1 UTSW 17 56017873 missense probably benign 0.00
R3684:Sh3gl1 UTSW 17 56018953 missense possibly damaging 0.91
R3792:Sh3gl1 UTSW 17 56018949 missense probably damaging 1.00
R4282:Sh3gl1 UTSW 17 56036456 missense probably damaging 1.00
R4298:Sh3gl1 UTSW 17 56019173 missense probably damaging 1.00
R5868:Sh3gl1 UTSW 17 56019119 missense probably damaging 1.00
R6304:Sh3gl1 UTSW 17 56036431 missense probably benign 0.01
R6379:Sh3gl1 UTSW 17 56019143 missense probably damaging 1.00
R6523:Sh3gl1 UTSW 17 56017617 missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TCAAAATCATAAAGCGCCTTGCAGC -3'
(R):5'- AAATGGCAGTGGTAGCCTGAGC -3'

Sequencing Primer
(F):5'- CTTGTCTGACGATCTAAATGATGAGG -3'
(R):5'- CAGTGGTAGCCTGAGCTAGAAG -3'
Posted On2013-04-11