Incidental Mutation 'R1803:Cdkal1'
ID203320
Institutional Source Beutler Lab
Gene Symbol Cdkal1
Ensembl Gene ENSMUSG00000006191
Gene NameCDK5 regulatory subunit associated protein 1-like 1
Synonyms
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location29191746-29855674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29517471 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 332 (M332L)
Ref Sequence ENSEMBL: ENSMUSP00000122249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006353] [ENSMUST00000137225] [ENSMUST00000140278]
Predicted Effect probably damaging
Transcript: ENSMUST00000006353
AA Change: M332L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000006353
Gene: ENSMUSG00000006191
AA Change: M332L

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:UPF0004 64 152 5.7e-24 PFAM
Elp3 202 421 1.88e-40 SMART
Pfam:TRAM 430 491 7e-9 PFAM
low complexity region 554 568 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131792
Predicted Effect probably benign
Transcript: ENSMUST00000137225
SMART Domains Protein: ENSMUSP00000117404
Gene: ENSMUSG00000006191

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:UPF0004 64 152 9.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140278
AA Change: M332L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000122249
Gene: ENSMUSG00000006191
AA Change: M332L

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
Pfam:UPF0004 64 152 8.7e-24 PFAM
Elp3 202 421 1.88e-40 SMART
Pfam:TRAM 430 491 9.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153086
Predicted Effect probably benign
Transcript: ENSMUST00000154209
SMART Domains Protein: ENSMUSP00000121792
Gene: ENSMUSG00000006191

DomainStartEndE-ValueType
Blast:Elp3 2 89 1e-55 BLAST
PDB:2QGQ|H 4 83 2e-8 PDB
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the methylthiotransferase family. The function of this gene is not known. Genome-wide association studies have linked single nucleotide polymorphisms in an intron of this gene with susceptibilty to type 2 diabetes. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit impaired tRNALys modification. Mice homozygous for a gene trap allele exhibit altered glucose homeostasis and lipid accumulation at early stages when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morc1 A T 16: 48,622,638 T829S probably benign Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Cdkal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Cdkal1 APN 13 29517510 missense probably benign 0.01
IGL03111:Cdkal1 APN 13 29354701 missense possibly damaging 0.52
R0450:Cdkal1 UTSW 13 29691596 splice site probably null
R0510:Cdkal1 UTSW 13 29691596 splice site probably null
R0513:Cdkal1 UTSW 13 29625965 intron probably benign
R0631:Cdkal1 UTSW 13 29354684 nonsense probably null
R1309:Cdkal1 UTSW 13 29357583 missense possibly damaging 0.80
R1515:Cdkal1 UTSW 13 29326150 missense probably damaging 0.98
R1774:Cdkal1 UTSW 13 29850048 missense probably damaging 1.00
R1815:Cdkal1 UTSW 13 29717791 missense possibly damaging 0.52
R2134:Cdkal1 UTSW 13 29354677 missense possibly damaging 0.93
R2219:Cdkal1 UTSW 13 29354758 missense probably benign 0.01
R2220:Cdkal1 UTSW 13 29354758 missense probably benign 0.01
R2389:Cdkal1 UTSW 13 29552236 missense probably damaging 1.00
R2497:Cdkal1 UTSW 13 29474541 missense unknown
R2964:Cdkal1 UTSW 13 29444035 missense unknown
R3769:Cdkal1 UTSW 13 29552403 splice site probably null
R5092:Cdkal1 UTSW 13 29846239 missense probably damaging 1.00
R5164:Cdkal1 UTSW 13 29625719 missense probably damaging 1.00
R5333:Cdkal1 UTSW 13 29326152 missense probably benign 0.01
R5514:Cdkal1 UTSW 13 29777287 missense probably damaging 1.00
R5630:Cdkal1 UTSW 13 29777215 critical splice donor site probably null
R5838:Cdkal1 UTSW 13 29691686 missense probably benign
R6729:Cdkal1 UTSW 13 29474695 missense probably damaging 1.00
Z1088:Cdkal1 UTSW 13 29777236 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGGAAACTCGAGGCTTGG -3'
(R):5'- AACGAGCAGGCCATTTGTTG -3'

Sequencing Primer
(F):5'- GCTTCCGGAGTCTCGCC -3'
(R):5'- GAGTGTTTCTTCTCCAGCACTAACAC -3'
Posted On2014-06-23