Incidental Mutation 'R1803:Morc1'
ID203328
Institutional Source Beutler Lab
Gene Symbol Morc1
Ensembl Gene ENSMUSG00000022652
Gene Namemicrorchidia 1
Synonyms
MMRRC Submission 039833-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R1803 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location48431237-48630900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48622638 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 829 (T829S)
Ref Sequence ENSEMBL: ENSMUSP00000023330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023330]
Predicted Effect probably benign
Transcript: ENSMUST00000023330
AA Change: T829S

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000023330
Gene: ENSMUSG00000022652
AA Change: T829S

DomainStartEndE-ValueType
Pfam:HATPase_c_3 24 161 3.8e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
coiled coil region 281 311 N/A INTRINSIC
Pfam:zf-CW 481 528 2e-14 PFAM
low complexity region 639 651 N/A INTRINSIC
coiled coil region 885 916 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232195
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of mouse morc and like the mouse protein it is testis-specific. Mouse studies support a testis-specific function since only male knockout mice are infertile; infertility is the only apparent defect. These studies further support a role for this protein early in spermatogenesis, possibly by affecting entry into apoptosis because testis from knockout mice show greatly increased numbers of apoptotic cells. [provided by RefSeq, Jan 2009]
PHENOTYPE: Inactivation of this locus results in small testes and male sterility, the latter owing to meiotic arrest. Mutant females exhibited histologically normal ovaries and were fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik A T 17: 79,627,666 probably benign Het
9330182L06Rik A G 5: 9,427,832 H410R probably benign Het
Adgrl3 C T 5: 81,771,617 R586* probably null Het
Arpp21 T C 9: 112,127,398 T471A possibly damaging Het
Blnk T C 19: 40,952,377 E194G probably damaging Het
Cd44 G A 2: 102,834,252 P332S probably damaging Het
Cd47 T C 16: 49,867,806 F30L possibly damaging Het
Cdh23 T C 10: 60,331,281 E1861G probably damaging Het
Cdkal1 T A 13: 29,517,471 M332L probably damaging Het
Cul9 A G 17: 46,503,097 S2284P probably damaging Het
Cyp2a5 G T 7: 26,835,546 probably null Het
Dcp2 T C 18: 44,395,917 I33T probably damaging Het
Ddx52 A T 11: 83,946,132 I150L probably damaging Het
Ddx58 A G 4: 40,224,013 S289P probably benign Het
Dennd5a T A 7: 109,898,613 T1067S probably benign Het
Dnpep A T 1: 75,309,414 L419* probably null Het
Dock8 A G 19: 25,132,235 K927R probably benign Het
Dpy19l4 A T 4: 11,281,020 V475E possibly damaging Het
Edf1 C T 2: 25,560,194 S41F probably damaging Het
Emilin1 C T 5: 30,917,738 P441L possibly damaging Het
Epha3 T C 16: 63,602,288 K579E probably benign Het
Exoc1 A G 5: 76,561,441 N23S probably benign Het
Fam212a A G 9: 107,984,739 V128A probably benign Het
Flt3 C A 5: 147,367,055 E358* probably null Het
Fzd1 A T 5: 4,756,385 I399K probably damaging Het
Gdi2 T A 13: 3,564,547 Y333* probably null Het
Gm10479 A G 12: 20,433,653 H91R probably benign Het
Gm10842 G A 11: 105,147,041 R50K unknown Het
Grin2c A T 11: 115,260,732 probably null Het
Grk2 C T 19: 4,294,883 V53M probably damaging Het
H2-M10.2 C T 17: 36,285,871 M104I probably benign Het
Hyou1 C T 9: 44,384,182 Q290* probably null Het
Itgb2 T C 10: 77,564,790 S746P probably benign Het
Jmjd7 C T 2: 120,030,108 L39F probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klhl2 T C 8: 64,759,797 E236G probably damaging Het
Krtap19-4 C A 16: 88,884,991 G26C unknown Het
Krtap4-16 G A 11: 99,851,172 T134I possibly damaging Het
Lamb2 A G 9: 108,488,099 H1318R probably benign Het
Mab21l3 G A 3: 101,835,130 T38M probably benign Het
Mfsd10 A T 5: 34,636,750 D6E possibly damaging Het
Mnat1 G T 12: 73,179,233 G91* probably null Het
Mns1 A T 9: 72,452,734 I389F probably damaging Het
Morn5 T A 2: 36,053,077 V63E probably benign Het
Mybpc1 T C 10: 88,553,295 T404A possibly damaging Het
Npc1l1 A T 11: 6,228,846 M188K probably damaging Het
Nrcam T A 12: 44,572,208 M846K probably benign Het
Nup210 A C 6: 91,074,282 F373C probably damaging Het
Olfr1299 G T 2: 111,664,754 S176I probably damaging Het
Olfr1465 A T 19: 13,314,171 V38E possibly damaging Het
Olfr830 T C 9: 18,876,080 V248A probably damaging Het
Osbpl8 T C 10: 111,275,049 S471P probably damaging Het
Plekhn1 A T 4: 156,222,381 I517N probably benign Het
Plin4 G T 17: 56,104,931 T700K probably damaging Het
Plxna4 A T 6: 32,517,444 V79D probably damaging Het
Prdm16 A T 4: 154,335,261 M897K probably damaging Het
Ptprg T A 14: 12,091,410 probably null Het
Rcan2 G T 17: 44,037,033 C211F probably damaging Het
Rxfp1 C T 3: 79,737,769 C9Y probably benign Het
Scn2a G A 2: 65,670,767 probably null Het
Scnn1a A C 6: 125,332,194 R264S probably damaging Het
Sema4g T C 19: 44,998,020 V345A probably benign Het
Sgo2b T A 8: 63,927,392 D802V probably benign Het
Slc25a21 G A 12: 56,858,087 T54I probably benign Het
Slc25a46 C T 18: 31,594,588 E223K probably damaging Het
Slc25a54 A G 3: 109,102,697 I171V probably benign Het
Slc7a6 T C 8: 106,192,456 V224A possibly damaging Het
Smchd1 A T 17: 71,387,006 V1248E probably damaging Het
Sort1 C A 3: 108,325,699 F196L probably damaging Het
Sptbn4 G A 7: 27,418,583 T357M probably damaging Het
Srrm3 T A 5: 135,857,129 W308R probably damaging Het
Stard9 A T 2: 120,701,489 E2742D probably benign Het
Tas1r1 T A 4: 152,032,248 I310F probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tff1 A T 17: 31,161,586 C85* probably null Het
Tlr11 C T 14: 50,360,647 T30I probably benign Het
Trio T C 15: 27,748,340 T1265A probably benign Het
Ttc7b T C 12: 100,407,002 M338V possibly damaging Het
Umod T A 7: 119,464,724 S620C probably damaging Het
Ust C A 10: 8,298,055 probably null Het
Vmn1r176 A T 7: 23,835,184 S181R probably damaging Het
Vmn1r202 T C 13: 22,502,143 T35A probably benign Het
Vmn1r39 C A 6: 66,804,911 R104L probably benign Het
Vps13b T A 15: 35,430,205 Y286* probably null Het
Zfp579 G A 7: 4,993,770 R381C probably damaging Het
Zfp85 A G 13: 67,751,628 S71P probably benign Het
Zfyve16 A T 13: 92,504,085 V1254E probably damaging Het
Other mutations in Morc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Morc1 APN 16 48612326 missense probably damaging 0.98
IGL00815:Morc1 APN 16 48460692 missense possibly damaging 0.62
IGL00939:Morc1 APN 16 48452589 missense probably damaging 0.99
IGL01321:Morc1 APN 16 48582462 missense probably benign 0.00
IGL01410:Morc1 APN 16 48612314 missense probably benign 0.16
IGL01557:Morc1 APN 16 48498766 missense probably damaging 1.00
IGL02118:Morc1 APN 16 48587104 missense probably benign 0.01
IGL02626:Morc1 APN 16 48615760 missense probably damaging 0.96
IGL02692:Morc1 APN 16 48510233 missense probably null 0.95
IGL02812:Morc1 APN 16 48558506 splice site probably benign
IGL03232:Morc1 APN 16 48630802 missense probably benign 0.06
IGL03331:Morc1 APN 16 48612368 splice site probably benign
IGL03408:Morc1 APN 16 48442412 missense probably damaging 1.00
R0545:Morc1 UTSW 16 48565657 missense probably benign 0.05
R0569:Morc1 UTSW 16 48587122 missense probably benign 0.02
R0699:Morc1 UTSW 16 48592614 missense probably benign 0.01
R1717:Morc1 UTSW 16 48452477 missense probably benign 0.01
R1728:Morc1 UTSW 16 48612297 missense probably benign 0.10
R1864:Morc1 UTSW 16 48592530 missense probably benign 0.01
R2008:Morc1 UTSW 16 48565646 missense probably benign 0.41
R2070:Morc1 UTSW 16 48592611 missense probably benign 0.00
R2071:Morc1 UTSW 16 48592611 missense probably benign 0.00
R4851:Morc1 UTSW 16 48561617 missense probably benign 0.02
R5013:Morc1 UTSW 16 48502336 missense probably benign 0.11
R5081:Morc1 UTSW 16 48502352 missense probably benign 0.01
R5259:Morc1 UTSW 16 48630769 missense probably benign 0.12
R5342:Morc1 UTSW 16 48618509 missense probably damaging 0.99
R5481:Morc1 UTSW 16 48561485 intron probably null
R5561:Morc1 UTSW 16 48449348 missense probably benign 0.43
R6356:Morc1 UTSW 16 48437289 missense probably damaging 1.00
R6526:Morc1 UTSW 16 48587124 nonsense probably null
R6743:Morc1 UTSW 16 48502320 missense probably damaging 0.98
R6940:Morc1 UTSW 16 48479845 nonsense probably null
R6994:Morc1 UTSW 16 48565621 missense probably benign 0.00
R6994:Morc1 UTSW 16 48618546 missense probably benign 0.39
R7009:Morc1 UTSW 16 48627070 missense possibly damaging 0.69
R7357:Morc1 UTSW 16 48622590 missense probably benign 0.14
X0013:Morc1 UTSW 16 48587068 missense probably benign 0.04
X0027:Morc1 UTSW 16 48498811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTAGCATCTATCTCTGCCAGAAG -3'
(R):5'- GCTCAGCATCTCAATAACGGAG -3'

Sequencing Primer
(F):5'- GCATCTATCTCTGCCAGAAGTTAAAC -3'
(R):5'- AGTCATGGCTAACTGTCTCAG -3'
Posted On2014-06-23