Incidental Mutation 'R1804:Ipo4'
ID203407
Institutional Source Beutler Lab
Gene Symbol Ipo4
Ensembl Gene ENSMUSG00000002319
Gene Nameimportin 4
Synonyms
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location55625400-55635957 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 55629456 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 668 (N668K)
Ref Sequence ENSEMBL: ENSMUSP00000123692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000125133] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect probably benign
Transcript: ENSMUST00000002395
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000047131
AA Change: N668K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319
AA Change: N668K

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125133
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127773
Predicted Effect probably damaging
Transcript: ENSMUST00000135221
AA Change: N668K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319
AA Change: N668K

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141425
Predicted Effect probably benign
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148942
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228754
Meta Mutation Damage Score 0.146 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Npc1 C T 18: 12,223,088 C42Y probably damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Ipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0277:Ipo4 UTSW 14 55632115 missense probably benign 0.03
R0344:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0467:Ipo4 UTSW 14 55635526 start codon destroyed probably null
R1167:Ipo4 UTSW 14 55635020 missense probably damaging 1.00
R1217:Ipo4 UTSW 14 55634359 missense probably damaging 0.98
R2270:Ipo4 UTSW 14 55634100 missense probably damaging 1.00
R3551:Ipo4 UTSW 14 55633103 missense probably benign 0.10
R4561:Ipo4 UTSW 14 55630089 splice site probably benign
R4801:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4802:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4804:Ipo4 UTSW 14 55630856 missense possibly damaging 0.80
R5384:Ipo4 UTSW 14 55626196 missense probably benign 0.28
R5493:Ipo4 UTSW 14 55630870 missense probably benign 0.00
R5527:Ipo4 UTSW 14 55632050 unclassified probably null
R5631:Ipo4 UTSW 14 55632069 missense probably damaging 1.00
R5631:Ipo4 UTSW 14 55633381 missense probably benign 0.08
R5788:Ipo4 UTSW 14 55628820 missense probably benign 0.02
R5929:Ipo4 UTSW 14 55631189 missense probably benign 0.03
R6018:Ipo4 UTSW 14 55626152 critical splice donor site probably null
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6707:Ipo4 UTSW 14 55628904 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CTTCATCGAAGGTGGCATCC -3'
(R):5'- TAGGAGGGGTGCTCTTCTAC -3'

Sequencing Primer
(F):5'- CATCGAAGGTGGCATCCATGAATG -3'
(R):5'- GCCTTTAATTCTAGCACTCAGGAGG -3'
Posted On2014-06-23