Incidental Mutation 'R1804:Npc1'
ID203420
Institutional Source Beutler Lab
Gene Symbol Npc1
Ensembl Gene ENSMUSG00000024413
Gene NameNPC intracellular cholesterol transporter 1
Synonymsnmf164, A430089E03Rik, D18Ertd723e, C85354, D18Ertd139e, lcsd
MMRRC Submission 039834-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.462) question?
Stock #R1804 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location12189693-12236400 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 12223088 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 42 (C42Y)
Ref Sequence ENSEMBL: ENSMUSP00000025279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025279]
Predicted Effect probably damaging
Transcript: ENSMUST00000025279
AA Change: C42Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025279
Gene: ENSMUSG00000024413
AA Change: C42Y

DomainStartEndE-ValueType
low complexity region 8 15 N/A INTRINSIC
Pfam:NPC1_N 22 267 1.6e-79 PFAM
transmembrane domain 269 291 N/A INTRINSIC
transmembrane domain 353 375 N/A INTRINSIC
Pfam:Patched 436 896 3.5e-52 PFAM
Pfam:MMPL 648 794 6.3e-8 PFAM
Pfam:Sterol-sensing 649 803 2.7e-56 PFAM
Pfam:Patched 1023 1252 2.9e-33 PFAM
low complexity region 1259 1273 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144435
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149211
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.5%
  • 20x: 89.8%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large protein that resides in the limiting membrane of endosomes and lysosomes and mediates intracellular cholesterol trafficking via binding of cholesterol to its N-terminal domain. It is predicted to have a cytoplasmic C-terminus, 13 transmembrane domains, and 3 large loops in the lumen of the endosome - the last loop being at the N-terminus. This protein transports low-density lipoproteins to late endosomal/lysosomal compartments where they are hydrolized and released as free cholesterol. Defects in this gene cause Niemann-Pick type C disease, a rare autosomal recessive neurodegenerative disorder characterized by over accumulation of cholesterol and glycosphingolipids in late endosomal/lysosomal compartments.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygotes for spontaneous and chemically induced mutations may exhibit lysosomal storage of non-esterified cholesterol, neurodegeneration, ataxia, presence of foam cells, sterility, and shortened lifespan. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,203 Y220H probably benign Het
2610507B11Rik A G 11: 78,273,469 H1165R probably damaging Het
4930579C12Rik T C 9: 89,152,060 noncoding transcript Het
Abcc8 T C 7: 46,120,479 S871G probably benign Het
Acly T C 11: 100,515,905 Y288C probably damaging Het
Adgrb1 T A 15: 74,529,540 D128E probably damaging Het
AF529169 T A 9: 89,603,099 M82L possibly damaging Het
Alms1 C T 6: 85,621,275 Q1497* probably null Het
Cacna1c G A 6: 118,687,046 T688M probably damaging Het
Ccdc7a A T 8: 128,988,766 L279* probably null Het
Cep135 A G 5: 76,636,932 E958G probably benign Het
Clec4n G T 6: 123,230,022 V2L possibly damaging Het
Col28a1 C T 6: 8,164,612 probably null Het
Dcaf5 A G 12: 80,339,829 S508P probably benign Het
Dlgap2 C A 8: 14,727,809 N351K possibly damaging Het
Dnah8 T A 17: 30,708,407 Y1346N probably benign Het
Dqx1 T C 6: 83,060,322 V322A probably damaging Het
Ebf3 A C 7: 137,200,521 L412V possibly damaging Het
Epha5 T C 5: 84,331,815 N110S probably benign Het
Fcgbp T C 7: 28,086,139 C334R probably benign Het
Glp1r T A 17: 30,930,713 probably null Het
Gm4952 G T 19: 12,618,420 R58L probably damaging Het
Gm7579 G A 7: 142,211,938 C27Y unknown Het
Golm1 T A 13: 59,642,389 probably null Het
Gucy2g T A 19: 55,210,309 I801F probably benign Het
H2-D1 T C 17: 35,263,552 Y83H probably damaging Het
Homez A T 14: 54,857,141 I19N probably damaging Het
Hoxa5 T C 6: 52,202,648 K249R probably damaging Het
Hsd17b4 A T 18: 50,177,984 N550Y probably damaging Het
Ipo4 A T 14: 55,629,456 N668K probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klb A G 5: 65,379,853 D842G probably damaging Het
Mmp21 G T 7: 133,678,882 P120T probably benign Het
Mroh7 T A 4: 106,694,392 I918F possibly damaging Het
Muc5b A G 7: 141,863,780 T3488A possibly damaging Het
Ogdh A G 11: 6,338,565 Y214C probably damaging Het
Olfr1042 G T 2: 86,160,073 T99N probably benign Het
Olfr1277 T C 2: 111,269,930 M146V probably benign Het
Olfr450 G A 6: 42,818,221 C250Y possibly damaging Het
Olfr726 A T 14: 50,083,902 W260R probably damaging Het
Olfr930 A G 9: 38,930,650 T160A possibly damaging Het
Phtf1 A G 3: 103,987,567 probably benign Het
Plb1 A G 5: 32,353,697 N1302S possibly damaging Het
Prex2 A G 1: 11,132,342 K492E probably damaging Het
Prkaa1 A G 15: 5,178,778 D509G probably benign Het
Rims2 C T 15: 39,437,043 Q57* probably null Het
Rnf40 T C 7: 127,595,948 V411A possibly damaging Het
Rraga A G 4: 86,576,444 I176V probably damaging Het
Rrm2 T C 12: 24,708,612 I51T probably benign Het
Serpina3a T A 12: 104,118,416 probably benign Het
Skint7 T C 4: 111,982,012 W168R probably damaging Het
Slc27a4 A G 2: 29,811,267 M357V probably benign Het
Slc4a3 A G 1: 75,551,717 H452R probably damaging Het
Smc1b A T 15: 85,127,790 I127K possibly damaging Het
Snap91 T A 9: 86,783,417 M383L probably benign Het
Taf6l A T 19: 8,773,634 L52Q probably damaging Het
Tas1r3 G A 4: 155,860,470 R765C probably damaging Het
Tas2r124 A G 6: 132,755,525 I266V probably benign Het
Tesk2 T C 4: 116,800,621 probably benign Het
Tmem131l T G 3: 83,910,479 Q1237P possibly damaging Het
Tmem67 A G 4: 12,045,789 probably null Het
Tnfaip8 T A 18: 50,090,661 C179S probably damaging Het
Ush2a G A 1: 188,633,729 probably null Het
Vps13b A T 15: 35,917,137 E3709V probably damaging Het
Wdr7 A T 18: 63,865,440 S1153C probably damaging Het
Zc2hc1b A C 10: 13,171,268 probably benign Het
Zfp438 A G 18: 5,213,689 I423T probably damaging Het
Zfp592 C A 7: 81,023,695 P136T probably damaging Het
Zfp783 T A 6: 47,945,885 noncoding transcript Het
Zfp804b A T 5: 6,771,756 S400T possibly damaging Het
Other mutations in Npc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02347:Npc1 APN 18 12199634 missense probably benign 0.45
IGL02523:Npc1 APN 18 12201572 missense probably benign 0.00
IGL03018:Npc1 APN 18 12214379 missense probably damaging 0.99
IGL03101:Npc1 APN 18 12198539 missense probably benign 0.15
IGL03151:Npc1 APN 18 12219275 missense probably benign 0.05
IGL03377:Npc1 APN 18 12211821 missense probably benign
PIT4354001:Npc1 UTSW 18 12211535 missense probably benign 0.00
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0068:Npc1 UTSW 18 12208367 missense probably benign 0.04
R0190:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R0200:Npc1 UTSW 18 12219204 missense probably damaging 1.00
R0485:Npc1 UTSW 18 12213446 missense probably benign 0.00
R0699:Npc1 UTSW 18 12210575 missense probably benign 0.00
R0730:Npc1 UTSW 18 12219325 missense probably benign 0.00
R1302:Npc1 UTSW 18 12195085 missense probably benign 0.00
R1442:Npc1 UTSW 18 12195049 missense probably benign
R1463:Npc1 UTSW 18 12191830 missense probably damaging 1.00
R1808:Npc1 UTSW 18 12194092 missense probably damaging 1.00
R1928:Npc1 UTSW 18 12213378 missense possibly damaging 0.79
R2112:Npc1 UTSW 18 12213472 missense possibly damaging 0.49
R2117:Npc1 UTSW 18 12196556 missense probably damaging 1.00
R2157:Npc1 UTSW 18 12191809 missense probably damaging 0.98
R2279:Npc1 UTSW 18 12197179 splice site probably null
R2311:Npc1 UTSW 18 12202183 missense probably benign
R2446:Npc1 UTSW 18 12214339 missense probably benign 0.01
R3004:Npc1 UTSW 18 12197254 missense probably benign 0.03
R4090:Npc1 UTSW 18 12198162 splice site probably null
R4304:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4308:Npc1 UTSW 18 12210527 missense possibly damaging 0.77
R4564:Npc1 UTSW 18 12191732 missense probably damaging 1.00
R4786:Npc1 UTSW 18 12199497 missense probably benign 0.35
R5243:Npc1 UTSW 18 12198631 intron probably benign
R5404:Npc1 UTSW 18 12213299 missense possibly damaging 0.79
R5823:Npc1 UTSW 18 12191789 missense possibly damaging 0.69
R6080:Npc1 UTSW 18 12219351 missense probably damaging 1.00
R6215:Npc1 UTSW 18 12236192 small deletion probably benign
R6301:Npc1 UTSW 18 12197245 missense probably benign 0.00
R6476:Npc1 UTSW 18 12201694 nonsense probably null
R7007:Npc1 UTSW 18 12210548 missense probably benign 0.02
R7020:Npc1 UTSW 18 12198537 missense probably damaging 1.00
R7048:Npc1 UTSW 18 12204765 splice site probably null
R7116:Npc1 UTSW 18 12211544 missense probably damaging 1.00
R7153:Npc1 UTSW 18 12213291 missense possibly damaging 0.78
R7359:Npc1 UTSW 18 12195180 missense probably benign 0.05
R7382:Npc1 UTSW 18 12201706 missense probably damaging 0.99
X0012:Npc1 UTSW 18 12193311 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACGTCTTTACAGATTTCAGCCC -3'
(R):5'- AATCCATTTGGGGTTTTAGGCC -3'

Sequencing Primer
(F):5'- GTCTTTACAGATTTCAGCCCTCTAG -3'
(R):5'- AGACTGGCCTTGAACTCATG -3'
Posted On2014-06-23