Incidental Mutation 'R1806:Pomt1'
ID203432
Institutional Source Beutler Lab
Gene Symbol Pomt1
Ensembl Gene ENSMUSG00000039254
Gene Nameprotein-O-mannosyltransferase 1
Synonyms
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R1806 (G1)
Quality Score178
Status Validated
Chromosome2
Chromosomal Location32236590-32255005 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32241668 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 123 (V123E)
Ref Sequence ENSEMBL: ENSMUSP00000116117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036473] [ENSMUST00000123740] [ENSMUST00000146485]
Predicted Effect probably damaging
Transcript: ENSMUST00000036473
AA Change: V121E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038722
Gene: ENSMUSG00000039254
AA Change: V121E

DomainStartEndE-ValueType
Pfam:PMT 42 289 2.8e-96 PFAM
MIR 318 381 7.45e-8 SMART
MIR 392 449 1.65e-9 SMART
MIR 456 513 6.2e-5 SMART
Pfam:PMT_4TMC 542 740 3.9e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123740
AA Change: V99E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116543
Gene: ENSMUSG00000039254
AA Change: V99E

DomainStartEndE-ValueType
Pfam:PMT 20 233 1.3e-84 PFAM
Pfam:PMT_2 64 229 3.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126784
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129163
Predicted Effect probably benign
Transcript: ENSMUST00000132516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132853
Predicted Effect probably damaging
Transcript: ENSMUST00000146485
AA Change: V123E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116117
Gene: ENSMUSG00000039254
AA Change: V123E

DomainStartEndE-ValueType
Pfam:PMT 44 227 9e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154684
Meta Mutation Damage Score 0.438 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an O-mannosyltransferase that requires interaction with the product of the POMT2 gene for enzymatic function. The encoded protein is found in the membrane of the endoplasmic reticulum. Defects in this gene are a cause of Walker-Warburg syndrome (WWS) and limb-girdle muscular dystrophy type 2K (LGMD2K). Several transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in embryonic lethality with disruption of Reichert's membrane. Heterozygous mutation with a second allele results in ectasia in kidney and liver veins and an increased neutrophil count. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Pomt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Pomt1 APN 2 32241772 missense probably benign
IGL01926:Pomt1 APN 2 32243472 missense probably benign 0.23
IGL02237:Pomt1 APN 2 32245677 missense probably benign 0.18
IGL02281:Pomt1 APN 2 32248646 missense possibly damaging 0.95
IGL03001:Pomt1 APN 2 32244326 missense probably benign
IGL03216:Pomt1 APN 2 32242943 missense probably damaging 0.99
IGL03343:Pomt1 APN 2 32253712 splice site probably benign
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0049:Pomt1 UTSW 2 32252011 missense possibly damaging 0.88
R0975:Pomt1 UTSW 2 32253895 critical splice donor site probably null
R1199:Pomt1 UTSW 2 32250492 missense probably benign
R1414:Pomt1 UTSW 2 32243610 splice site probably benign
R1421:Pomt1 UTSW 2 32236753 unclassified probably benign
R2173:Pomt1 UTSW 2 32250900 missense probably damaging 1.00
R2209:Pomt1 UTSW 2 32250862 missense possibly damaging 0.90
R2302:Pomt1 UTSW 2 32243659 missense probably benign 0.00
R3084:Pomt1 UTSW 2 32244240 missense probably benign 0.02
R3774:Pomt1 UTSW 2 32244250 missense possibly damaging 0.93
R3933:Pomt1 UTSW 2 32245619 missense probably benign 0.00
R4177:Pomt1 UTSW 2 32248677 missense probably damaging 0.99
R4626:Pomt1 UTSW 2 32254412 missense possibly damaging 0.84
R4645:Pomt1 UTSW 2 32242876 intron probably benign
R4864:Pomt1 UTSW 2 32251992 missense probably benign 0.02
R4911:Pomt1 UTSW 2 32241679 missense probably damaging 0.97
R5143:Pomt1 UTSW 2 32254329 missense probably benign 0.23
R5288:Pomt1 UTSW 2 32244299 nonsense probably null
R5385:Pomt1 UTSW 2 32244299 nonsense probably null
R5718:Pomt1 UTSW 2 32248692 missense possibly damaging 0.91
R5735:Pomt1 UTSW 2 32243505 missense probably damaging 1.00
R5754:Pomt1 UTSW 2 32247590 missense probably damaging 0.99
R5817:Pomt1 UTSW 2 32248679 missense probably damaging 0.97
R6304:Pomt1 UTSW 2 32250790 missense probably damaging 1.00
R6477:Pomt1 UTSW 2 32248716 splice site probably null
R6793:Pomt1 UTSW 2 32242949 missense probably damaging 1.00
R6918:Pomt1 UTSW 2 32252861 splice site probably null
R7114:Pomt1 UTSW 2 32253836 missense not run
Predicted Primers PCR Primer
(F):5'- CCACATCTATGCTCGGTGAG -3'
(R):5'- TTCTCTTCACAGGCAGGTGG -3'

Sequencing Primer
(F):5'- GCTGATATTTACTACCCAGAGAGGC -3'
(R):5'- GGCAGTGACCCAAGGCTTAC -3'
Posted On2014-06-23