Incidental Mutation 'R1806:Galnt9'
ID203452
Institutional Source Beutler Lab
Gene Symbol Galnt9
Ensembl Gene ENSMUSG00000033316
Gene Namepolypeptide N-acetylgalactosaminyltransferase 9
SynonymsGalNAc-T9
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R1806 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110544355-110621380 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 110619253 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 530 (D530G)
Ref Sequence ENSEMBL: ENSMUSP00000038633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040001] [ENSMUST00000165856] [ENSMUST00000200404]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040001
AA Change: D530G

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038633
Gene: ENSMUSG00000033316
AA Change: D530G

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
low complexity region 87 100 N/A INTRINSIC
Pfam:Glycos_transf_2 155 341 4.3e-26 PFAM
Blast:UBCc 425 457 3e-6 BLAST
RICIN 466 596 6.74e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165856
AA Change: D163G

PolyPhen 2 Score 0.222 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133111
Gene: ENSMUSG00000033316
AA Change: D163G

DomainStartEndE-ValueType
Blast:UBCc 58 90 1e-6 BLAST
RICIN 99 229 6.74e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200404
SMART Domains Protein: ENSMUSP00000143647
Gene: ENSMUSG00000033316

DomainStartEndE-ValueType
PDB:1XHB|A 1 132 7e-27 PDB
Blast:UBCc 58 90 2e-7 BLAST
SCOP:d1abrb1 92 133 8e-5 SMART
Blast:RICIN 99 136 1e-18 BLAST
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. This gene is expressed specifically in the brain, with highest expression in the cerebellum. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Galnt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01746:Galnt9 APN 5 110588322 missense probably damaging 1.00
IGL01934:Galnt9 APN 5 110602636 missense possibly damaging 0.56
IGL02394:Galnt9 APN 5 110615499 missense probably damaging 0.99
IGL02468:Galnt9 APN 5 110614223 missense possibly damaging 0.68
R1494:Galnt9 UTSW 5 110588330 missense probably damaging 1.00
R1703:Galnt9 UTSW 5 110619172 missense probably damaging 1.00
R1717:Galnt9 UTSW 5 110596212 missense probably benign 0.01
R1855:Galnt9 UTSW 5 110615524 missense probably damaging 1.00
R4039:Galnt9 UTSW 5 110614208 missense probably damaging 1.00
R4388:Galnt9 UTSW 5 110588391 missense probably damaging 0.99
R4636:Galnt9 UTSW 5 110615499 missense probably damaging 0.99
R4693:Galnt9 UTSW 5 110615509 missense probably damaging 1.00
R4921:Galnt9 UTSW 5 110577449 missense probably damaging 0.96
R4925:Galnt9 UTSW 5 110544739 missense possibly damaging 0.54
R5040:Galnt9 UTSW 5 110617905 missense probably damaging 1.00
R5239:Galnt9 UTSW 5 110544769 missense probably damaging 1.00
R5839:Galnt9 UTSW 5 110577520 missense probably benign
R5918:Galnt9 UTSW 5 110615466 missense probably damaging 1.00
R6734:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6775:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6777:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
R6784:Galnt9 UTSW 5 110620599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATTGATGAAGGCCAGGGC -3'
(R):5'- CAAACTTTCTGTGCAACAGGG -3'

Sequencing Primer
(F):5'- GCCAGGGCATAGATAAATACCTTG -3'
(R):5'- GTGGCAAAGCATATCTCTGC -3'
Posted On2014-06-23