Incidental Mutation 'R1806:Uba3'
ID203459
Institutional Source Beutler Lab
Gene Symbol Uba3
Ensembl Gene ENSMUSG00000030061
Gene Nameubiquitin-like modifier activating enzyme 3
Synonymsubiquitin activating enzyme 3, A830034N06Rik, Ube1c
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1806 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location97183670-97205647 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97199269 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 92 (V92A)
Ref Sequence ENSEMBL: ENSMUSP00000130954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089287] [ENSMUST00000164744] [ENSMUST00000204056]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089287
AA Change: V106A

PolyPhen 2 Score 0.697 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000086701
Gene: ENSMUSG00000030061
AA Change: V106A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:ThiF 53 369 2.6e-69 PFAM
E2_bind 374 462 1.02e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164744
AA Change: V92A

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130954
Gene: ENSMUSG00000030061
AA Change: V92A

DomainStartEndE-ValueType
Pfam:ThiF 54 199 1.5e-41 PFAM
Pfam:UBA_e1_thiolCys 202 248 8.7e-15 PFAM
Pfam:UBACT 255 321 9e-25 PFAM
E2_bind 360 448 1.02e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203215
Predicted Effect probably benign
Transcript: ENSMUST00000204056
SMART Domains Protein: ENSMUSP00000145309
Gene: ENSMUSG00000030061

DomainStartEndE-ValueType
low complexity region 5 56 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204917
Meta Mutation Damage Score 0.252 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: The protein encoded by this gene is the catalytic subunit of the enzyme that activates NEDD8, a ubiquitin-like molecule that binds to its target proteins through an enzymatic reaction analagous to ubiquitylation. Embryonic mice deficient for this protein die prior to implantation and display apoptosis of the inner cell mass. Trophoblastic cells cannot enter S phase, demonstrating that this gene is required for cell cycle progression during embryogenesis. Two pseudogenes have been found for this gene. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mutants die at the peri-implantation stage. Mutants exhibit selective apoptosis of the inner cell mass but not of trophoblastic cells. Moreover, the trophoblastic cells fail to enter the S phase of the endoreduplication cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Bckdha A G 7: 25,631,420 V307A probably damaging Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Uba3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0295:Uba3 UTSW 6 97191583 missense possibly damaging 0.71
R0554:Uba3 UTSW 6 97191260 splice site probably null
R0780:Uba3 UTSW 6 97186705 nonsense probably null
R1572:Uba3 UTSW 6 97185337 splice site probably benign
R1759:Uba3 UTSW 6 97196904 missense probably damaging 1.00
R2076:Uba3 UTSW 6 97199280 missense probably damaging 1.00
R2907:Uba3 UTSW 6 97203553 missense probably benign 0.00
R3237:Uba3 UTSW 6 97186240 missense probably damaging 1.00
R5238:Uba3 UTSW 6 97201935 nonsense probably null
R6293:Uba3 UTSW 6 97196908 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGTTTCTAGCACTCTCACAG -3'
(R):5'- AGGACTTAAACCTGAGTGCTTG -3'

Sequencing Primer
(F):5'- TCTCACAGAGACATAAATAAATGCAG -3'
(R):5'- GGAAAGGAAACTGTTGCCTA -3'
Posted On2014-06-23