Incidental Mutation 'R0110:Traf3ip3'
ID20346
Institutional Source Beutler Lab
Gene Symbol Traf3ip3
Ensembl Gene ENSMUSG00000037318
Gene NameTRAF3 interacting protein 3
Synonyms6030423D04Rik
MMRRC Submission 038396-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0110 (G1)
Quality Score209
Status Validated (trace)
Chromosome1
Chromosomal Location193175453-193201703 bp(-) (GRCm38)
Type of Mutationunclassified (1006 bp from exon)
DNA Base Change (assembly) T to A at 193178231 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000043550] [ENSMUST00000110831] [ENSMUST00000160077] [ENSMUST00000160822] [ENSMUST00000161235] [ENSMUST00000178744] [ENSMUST00000191613] [ENSMUST00000192020] [ENSMUST00000192189] [ENSMUST00000193307] [ENSMUST00000194278]
Predicted Effect probably damaging
Transcript: ENSMUST00000043550
AA Change: E461V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000040977
Gene: ENSMUSG00000037318
AA Change: E461V

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110831
SMART Domains Protein: ENSMUSP00000106455
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160077
SMART Domains Protein: ENSMUSP00000141934
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 163 6.7e-36 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160332
Predicted Effect probably benign
Transcript: ENSMUST00000160822
SMART Domains Protein: ENSMUSP00000124546
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 15 263 2.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161235
SMART Domains Protein: ENSMUSP00000124191
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178744
SMART Domains Protein: ENSMUSP00000136653
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 263 1.4e-83 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191613
SMART Domains Protein: ENSMUSP00000141799
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 70 7.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000192020
AA Change: E461V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000141698
Gene: ENSMUSG00000037318
AA Change: E461V

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
coiled coil region 279 486 N/A INTRINSIC
transmembrane domain 487 506 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192189
Predicted Effect probably benign
Transcript: ENSMUST00000193307
SMART Domains Protein: ENSMUSP00000142273
Gene: ENSMUSG00000079144

DomainStartEndE-ValueType
Pfam:DUF4504 13 84 3.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194278
SMART Domains Protein: ENSMUSP00000141661
Gene: ENSMUSG00000037318

DomainStartEndE-ValueType
low complexity region 23 44 N/A INTRINSIC
Meta Mutation Damage Score 0.292 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 95.3%
  • 20x: 89.0%
Validation Efficiency 98% (105/107)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a protein that mediates cell growth by modulating the c-Jun N-terminal kinase signal transduction pathway. The encoded protein may also interact with a large multi-protein assembly containing the phosphatase 2A catalytic subunit. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired single positive thymocyte development and increased gamma-delta T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 99 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930486L24Rik A T 13: 60,853,506 probably benign Het
4933408B17Rik A T 18: 34,596,151 D42E probably damaging Het
Abcg3 A G 5: 104,977,616 I67T probably damaging Het
Adam10 T A 9: 70,748,248 W333R probably damaging Het
Ahnak C T 19: 9,018,232 R5627* probably null Het
AI606181 A C 19: 41,593,731 K113N unknown Het
Alms1 A T 6: 85,620,369 R1195* probably null Het
Ankrd11 T C 8: 122,892,175 D1646G possibly damaging Het
Ap2m1 T A 16: 20,542,240 I334N possibly damaging Het
Arpc1b T A 5: 145,127,715 W361R probably damaging Het
Baiap2l1 T C 5: 144,275,891 Y438C probably damaging Het
Ccdc110 T A 8: 45,935,157 N50K probably benign Het
Cdhr1 T C 14: 37,080,676 Y610C probably damaging Het
Celsr3 G A 9: 108,827,005 C229Y possibly damaging Het
Clca4b A T 3: 144,913,351 Y676N probably damaging Het
Cntln C T 4: 85,096,757 T1095I probably damaging Het
Cog2 T C 8: 124,529,058 probably null Het
Col11a1 A T 3: 114,105,456 probably benign Het
Cpe T A 8: 64,611,467 I233F probably damaging Het
Dcaf11 T C 14: 55,569,080 V446A probably damaging Het
Defa34 A G 8: 21,665,972 probably null Het
Dnah12 A G 14: 26,798,899 R1892G probably damaging Het
Dock4 A G 12: 40,621,312 probably benign Het
Dync1h1 C A 12: 110,639,944 Q2483K probably benign Het
Enpp3 A T 10: 24,776,781 D759E probably damaging Het
Epyc A G 10: 97,649,763 T22A probably benign Het
Fam227b T A 2: 126,100,921 S319C probably damaging Het
Fam83a C A 15: 58,009,926 Q384K probably benign Het
Fam83b G T 9: 76,492,826 L332I possibly damaging Het
Gal3st2c C T 1: 94,009,497 P388L probably benign Het
Ggn C T 7: 29,171,296 P47S probably damaging Het
Gli3 T G 13: 15,724,785 L919R probably damaging Het
Gm5134 C A 10: 75,974,245 T120N probably benign Het
Gm5415 T A 1: 32,545,875 N318I possibly damaging Het
Gm8251 C A 1: 44,059,224 V905F probably benign Het
Gmip C T 8: 69,815,609 probably benign Het
Gpr39 C T 1: 125,677,500 T55M probably damaging Het
Grk4 A G 5: 34,716,213 T208A probably damaging Het
Gsdme C A 6: 50,246,127 probably benign Het
Gucy2e T C 11: 69,235,576 D326G probably benign Het
Hadhb T C 5: 30,169,485 probably benign Het
Hectd4 T A 5: 121,281,896 Y635N possibly damaging Het
Hectd4 G A 5: 121,305,673 E1319K possibly damaging Het
Ikbkb A T 8: 22,671,635 C412* probably null Het
Itpa A T 2: 130,679,418 probably benign Het
Klhl10 A G 11: 100,456,932 T605A probably benign Het
Krt74 T C 15: 101,763,316 noncoding transcript Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lap3 T C 5: 45,495,290 probably benign Het
Lrrc10 T A 10: 117,045,790 L123Q probably damaging Het
Map3k6 T C 4: 133,243,794 L273P probably damaging Het
Mbl1 A G 14: 41,158,749 N198S probably damaging Het
Mcf2l A G 8: 12,997,337 D233G probably damaging Het
Mdga2 T C 12: 66,470,926 K45E possibly damaging Het
Mdn1 A G 4: 32,738,619 N3524S probably benign Het
Mrc1 T A 2: 14,238,542 probably benign Het
Msto1 A G 3: 88,911,541 L269P probably benign Het
Mtcl1 C T 17: 66,358,114 E1149K possibly damaging Het
Naca C T 10: 128,044,790 A1897V probably benign Het
Ncapg T C 5: 45,693,147 probably benign Het
Neb A T 2: 52,290,743 probably benign Het
Olfr467 T C 7: 107,814,688 Y35H probably damaging Het
Olfr870 T C 9: 20,171,265 Y102C probably benign Het
Olfr944 G A 9: 39,217,728 V124I possibly damaging Het
Parp2 T A 14: 50,819,673 Y361N probably damaging Het
Parp3 A G 9: 106,471,796 F466L possibly damaging Het
Pcdh15 A T 10: 74,290,976 N296Y probably damaging Het
Pcf11 G A 7: 92,657,831 P1043L probably damaging Het
Pdzrn3 A T 6: 101,151,053 I884N probably damaging Het
Phf24 G T 4: 42,933,761 V48L possibly damaging Het
Pla2g4a T A 1: 149,840,647 M688L possibly damaging Het
Plcl2 T C 17: 50,607,982 L673P probably damaging Het
Ppp1r3c A T 19: 36,734,217 F51Y possibly damaging Het
Prmt1 A G 7: 44,978,801 probably benign Het
Proc G A 18: 32,125,118 T258I probably benign Het
Prom2 T G 2: 127,531,113 S679R possibly damaging Het
Psen2 T C 1: 180,238,914 T153A probably damaging Het
Rem2 T C 14: 54,476,297 probably benign Het
Rin2 A G 2: 145,861,033 K550E probably benign Het
Rtn4 T A 11: 29,733,849 probably benign Het
Ssh1 A T 5: 113,946,705 D448E probably benign Het
Ssmem1 A T 6: 30,519,548 probably null Het
Stam2 A T 2: 52,719,986 probably benign Het
Syne1 A G 10: 5,367,600 L498P probably damaging Het
Syne2 AGAGTGAG AGAGTGAGTGAG 12: 76,097,960 probably null Het
Taf6l G T 19: 8,778,521 H254Q probably benign Het
Tas2r123 T C 6: 132,847,332 V64A probably benign Het
Tnnc1 A G 14: 31,211,408 D149G probably damaging Het
Tpp2 T A 1: 43,978,504 V756E probably benign Het
Tpp2 A G 1: 43,999,693 D1133G probably damaging Het
Tsen15 A G 1: 152,371,797 V148A probably damaging Het
Ttn T A 2: 76,864,328 probably benign Het
Ube2u A G 4: 100,486,673 I90V probably benign Het
Unc79 T A 12: 103,079,070 probably null Het
Usp47 T C 7: 112,056,580 S155P possibly damaging Het
Wdr41 T C 13: 95,018,111 probably benign Het
Zfp217 C T 2: 170,115,462 A539T probably benign Het
Zfp423 A G 8: 87,782,259 S486P possibly damaging Het
Zfp628 A T 7: 4,919,733 Q318L probably benign Het
Other mutations in Traf3ip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Traf3ip3 APN 1 193194820 intron probably benign
IGL00663:Traf3ip3 APN 1 193187138 missense probably damaging 1.00
IGL01125:Traf3ip3 APN 1 193184464 splice site probably null
IGL01308:Traf3ip3 APN 1 193184891 missense probably damaging 1.00
IGL01608:Traf3ip3 APN 1 193187110 missense probably benign 0.00
IGL02225:Traf3ip3 APN 1 193195100 missense probably benign 0.03
IGL02432:Traf3ip3 APN 1 193184576 missense probably damaging 1.00
IGL03102:Traf3ip3 APN 1 193195077 missense probably damaging 1.00
IGL03179:Traf3ip3 APN 1 193194368 missense probably damaging 1.00
IGL02988:Traf3ip3 UTSW 1 193194874 unclassified probably null
R0469:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0510:Traf3ip3 UTSW 1 193178231 unclassified probably null
R0529:Traf3ip3 UTSW 1 193194811 intron probably benign
R1165:Traf3ip3 UTSW 1 193184478 missense probably damaging 0.99
R1559:Traf3ip3 UTSW 1 193178291 missense probably damaging 0.99
R1729:Traf3ip3 UTSW 1 193181893 missense probably benign 0.01
R1896:Traf3ip3 UTSW 1 193175734 missense probably benign
R4085:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4086:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4087:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4088:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4090:Traf3ip3 UTSW 1 193181320 missense probably damaging 0.98
R4258:Traf3ip3 UTSW 1 193197946 missense probably damaging 1.00
R4817:Traf3ip3 UTSW 1 193184829 missense probably damaging 1.00
R5299:Traf3ip3 UTSW 1 193178175 nonsense probably null
R5906:Traf3ip3 UTSW 1 193198006 missense possibly damaging 0.55
R6268:Traf3ip3 UTSW 1 193198036 start gained probably benign
R6374:Traf3ip3 UTSW 1 193182010 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCATTGCCCCTAGAAGGGTTCTC -3'
(R):5'- TTCTACTCCATTCAGCGAAGCCAC -3'

Sequencing Primer
(F):5'- AAGGGTTCTCTGCCCCAC -3'
(R):5'- TCAGCGAAGCCACAGACAC -3'
Posted On2013-04-11