Incidental Mutation 'R1806:Bckdha'
ID203463
Institutional Source Beutler Lab
Gene Symbol Bckdha
Ensembl Gene ENSMUSG00000060376
Gene Namebranched chain ketoacid dehydrogenase E1, alpha polypeptide
SynonymsBCKAD E1[a]
MMRRC Submission 039835-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R1806 (G1)
Quality Score180
Status Validated
Chromosome7
Chromosomal Location25629946-25658981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25631420 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000071292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071329] [ENSMUST00000076034] [ENSMUST00000205281] [ENSMUST00000205808] [ENSMUST00000206940]
Predicted Effect probably damaging
Transcript: ENSMUST00000071329
AA Change: V307A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000071292
Gene: ENSMUSG00000060376
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Pfam:E1_dh 107 407 2.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076034
SMART Domains Protein: ENSMUSP00000092277
Gene: ENSMUSG00000059479

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:Galactosyl_T 154 344 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205281
Predicted Effect probably damaging
Transcript: ENSMUST00000205808
AA Change: V57A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206824
Predicted Effect probably benign
Transcript: ENSMUST00000206940
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.2%
Validation Efficiency 96% (77/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
Adamts15 C A 9: 30,904,815 C616F probably damaging Het
Adarb1 T C 10: 77,322,265 N116S probably damaging Het
Add2 C T 6: 86,118,657 S437L probably damaging Het
Adra1d T A 2: 131,546,149 R495S probably benign Het
Agk C T 6: 40,387,495 T309I probably damaging Het
Aqr T C 2: 114,161,652 Y81C probably damaging Het
Bak1 G A 17: 27,021,268 Q142* probably null Het
Camk2n2 C A 16: 20,620,198 G72V probably benign Het
Cd276 A T 9: 58,527,562 probably benign Het
Cd2ap G A 17: 42,838,758 Q122* probably null Het
Cdan1 T A 2: 120,731,426 probably benign Het
Cdh3 T C 8: 106,536,915 S156P probably benign Het
Chil4 T A 3: 106,210,643 probably benign Het
Col11a1 C T 3: 114,158,142 R1074C probably damaging Het
Fcrlb T C 1: 170,907,527 T344A probably benign Het
Fras1 T A 5: 96,713,970 probably benign Het
Fras1 G T 5: 96,764,976 V3380F possibly damaging Het
Galnt9 A G 5: 110,619,253 D530G possibly damaging Het
Gja10 A T 4: 32,601,135 S416R probably benign Het
Gm10549 T A 18: 33,470,788 V108E unknown Het
Gm8298 T C 3: 59,877,150 L348P probably damaging Het
Hook3 A T 8: 26,068,659 L59Q probably damaging Het
Hpf1 T A 8: 60,900,120 D178E probably benign Het
Hsd17b7 T C 1: 169,961,129 N173S possibly damaging Het
Hsph1 A G 5: 149,629,989 F236L probably damaging Het
Kcnk12 G T 17: 87,746,109 T375K probably benign Het
Kdelc2 T C 9: 53,395,850 Y365H probably damaging Het
Klra3 A T 6: 130,327,070 S220T probably damaging Het
Lhx1 A T 11: 84,524,141 L12Q probably damaging Het
Lnx1 A G 5: 74,606,049 L468P probably damaging Het
Ltbp3 T A 19: 5,753,942 C827* probably null Het
Mical1 C T 10: 41,478,214 A53V probably damaging Het
Mmp10 A T 9: 7,506,501 H326L probably benign Het
Mpl A T 4: 118,443,532 M600K possibly damaging Het
Muc5b T A 7: 141,865,493 D4004E possibly damaging Het
Myo5b A T 18: 74,577,609 H98L possibly damaging Het
Nbeal1 A G 1: 60,284,092 T2110A probably damaging Het
Nedd4l C A 18: 65,212,791 R825S probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1277 A T 2: 111,270,277 I30N possibly damaging Het
Olfr228 A T 2: 86,483,139 I201N probably damaging Het
Olfr596 T A 7: 103,310,225 L168Q probably damaging Het
Otog A T 7: 46,290,937 probably null Het
Parp2 T A 14: 50,819,379 L320H probably damaging Het
Pola2 C T 19: 5,943,222 probably null Het
Poln A T 5: 34,107,150 probably benign Het
Pomt1 T A 2: 32,241,668 V123E probably damaging Het
Prom2 T C 2: 127,532,882 Y578C probably damaging Het
Prss23 T C 7: 89,510,391 T157A probably damaging Het
Sdk1 T A 5: 141,613,195 V205E probably damaging Het
Sdk1 A G 5: 142,161,926 K1771R probably benign Het
Sidt1 A T 16: 44,281,871 S309T possibly damaging Het
Sirpa T A 2: 129,615,512 F169I probably damaging Het
Slc8a1 T C 17: 81,648,487 N374S probably damaging Het
Sp110 C T 1: 85,596,110 probably null Het
Stard9 A G 2: 120,679,453 probably null Het
Synpr A G 14: 13,563,082 N105S probably damaging Het
Tbc1d16 T C 11: 119,156,101 Y440C probably damaging Het
Trabd A G 15: 89,085,621 I313V possibly damaging Het
Trappc10 T C 10: 78,210,776 R430G probably damaging Het
Trim50 A G 5: 135,358,889 E145G probably benign Het
Uba2 A T 7: 34,163,199 F105I probably damaging Het
Uba3 A G 6: 97,199,269 V92A possibly damaging Het
Uhmk1 T C 1: 170,211,059 K153R probably damaging Het
Vmn2r3 T A 3: 64,275,472 M269L probably benign Het
Vmn2r3 T C 3: 64,287,389 K8R possibly damaging Het
Xpot G T 10: 121,607,638 probably benign Het
Zfp128 A G 7: 12,891,022 Y439C probably benign Het
Zfy1 T A Y: 725,620 H715L possibly damaging Het
Zmym1 A C 4: 127,048,079 L839V probably damaging Het
Other mutations in Bckdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Bckdha APN 7 25633342 missense probably benign 0.00
IGL01322:Bckdha APN 7 25658707 missense possibly damaging 0.75
IGL02279:Bckdha APN 7 25631109 missense probably damaging 1.00
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0194:Bckdha UTSW 7 25631450 missense probably damaging 1.00
R0615:Bckdha UTSW 7 25641785 missense probably benign 0.00
R2520:Bckdha UTSW 7 25641699 missense probably benign 0.18
R3847:Bckdha UTSW 7 25631652 missense probably damaging 1.00
R3975:Bckdha UTSW 7 25631433 missense probably damaging 1.00
R4630:Bckdha UTSW 7 25631459 missense probably damaging 1.00
R5655:Bckdha UTSW 7 25630364 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTGACCTCGTCCACCGAAC -3'
(R):5'- TGTCTGACAGTAAGGGCACAG -3'

Sequencing Primer
(F):5'- TACGCTGAGCTGTCGTCACTG -3'
(R):5'- CACAGGGGGCAATGAGC -3'
Posted On2014-06-23