Incidental Mutation 'R1807:Kif21b'
ID203505
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.193) question?
Stock #R1807 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136147793 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 219 (N219K)
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075164
AA Change: N219K

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642
AA Change: N219K

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect possibly damaging
Transcript: ENSMUST00000130864
AA Change: N219K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642
AA Change: N219K

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.0684 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Drd2 C T 9: 49,405,067 L376F probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Erbb2 T C 11: 98,428,854 Y591H probably damaging Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Me1 T A 9: 86,650,879 T197S probably damaging Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nfic T C 10: 81,404,985 T328A probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Recql5 T C 11: 115,895,115 K611E possibly damaging Het
Rexo1 A T 10: 80,542,579 I1180N possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4608:Kif21b UTSW 1 136148186 intron probably benign
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTATTTGACAGCACCCGTG -3'
(R):5'- ACCTCTGGAGTTCCTAGCCTAG -3'

Sequencing Primer
(F):5'- ACCACAGGTGTCACTTCTCG -3'
(R):5'- TAGCCTAGGCCCACGTTTG -3'
Posted On2014-06-23