Incidental Mutation 'R1807:Rexo1'
ID203549
Institutional Source Beutler Lab
Gene Symbol Rexo1
Ensembl Gene ENSMUSG00000047417
Gene NameREX1, RNA exonuclease 1
Synonyms2610511M11Rik, Tceb3bp1, 1700021P10Rik
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.448) question?
Stock #R1807 (G1)
Quality Score214
Status Validated
Chromosome10
Chromosomal Location80540922-80561560 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80542579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 1180 (I1180N)
Ref Sequence ENSEMBL: ENSMUSP00000049705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383] [ENSMUST00000057910] [ENSMUST00000183160] [ENSMUST00000219648] [ENSMUST00000220326]
Predicted Effect probably benign
Transcript: ENSMUST00000020383
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000057910
AA Change: I1180N

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000049705
Gene: ENSMUSG00000047417
AA Change: I1180N

DomainStartEndE-ValueType
low complexity region 34 53 N/A INTRINSIC
coiled coil region 83 113 N/A INTRINSIC
low complexity region 180 188 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
low complexity region 383 396 N/A INTRINSIC
low complexity region 440 453 N/A INTRINSIC
low complexity region 468 479 N/A INTRINSIC
low complexity region 507 525 N/A INTRINSIC
low complexity region 533 551 N/A INTRINSIC
low complexity region 561 583 N/A INTRINSIC
low complexity region 667 682 N/A INTRINSIC
Pfam:EloA-BP1 794 954 3.8e-72 PFAM
EXOIII 1051 1210 2.36e-38 SMART
Predicted Effect unknown
Transcript: ENSMUST00000182260
AA Change: I502N
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182682
Predicted Effect probably benign
Transcript: ENSMUST00000183073
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183139
Predicted Effect probably benign
Transcript: ENSMUST00000183160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183233
Predicted Effect probably benign
Transcript: ENSMUST00000219648
Predicted Effect probably benign
Transcript: ENSMUST00000220326
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Drd2 C T 9: 49,405,067 L376F probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Erbb2 T C 11: 98,428,854 Y591H probably damaging Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kif21b T A 1: 136,147,793 N219K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Me1 T A 9: 86,650,879 T197S probably damaging Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nfic T C 10: 81,404,985 T328A probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Recql5 T C 11: 115,895,115 K611E possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Rexo1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Rexo1 APN 10 80550964 missense probably damaging 0.99
IGL01128:Rexo1 APN 10 80549739 missense probably benign
IGL01890:Rexo1 APN 10 80543011 missense possibly damaging 0.85
R0044:Rexo1 UTSW 10 80544378 missense probably benign 0.16
R0365:Rexo1 UTSW 10 80542576 missense probably damaging 0.99
R0573:Rexo1 UTSW 10 80544850 missense probably damaging 1.00
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1146:Rexo1 UTSW 10 80544405 missense probably benign 0.04
R1511:Rexo1 UTSW 10 80550050 missense possibly damaging 0.93
R1523:Rexo1 UTSW 10 80542751 missense probably benign 0.41
R1868:Rexo1 UTSW 10 80542920 missense probably damaging 1.00
R1935:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1936:Rexo1 UTSW 10 80550469 missense probably benign 0.00
R1957:Rexo1 UTSW 10 80543366 missense probably damaging 0.96
R2084:Rexo1 UTSW 10 80561266 missense probably benign 0.01
R2153:Rexo1 UTSW 10 80544109 nonsense probably null
R2262:Rexo1 UTSW 10 80549569 missense probably benign 0.02
R4471:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4472:Rexo1 UTSW 10 80542658 missense probably damaging 1.00
R4690:Rexo1 UTSW 10 80546421 missense probably benign 0.01
R4972:Rexo1 UTSW 10 80549693 missense probably damaging 0.96
R6335:Rexo1 UTSW 10 80544081 missense probably damaging 1.00
R6505:Rexo1 UTSW 10 80543011 missense possibly damaging 0.85
R6615:Rexo1 UTSW 10 80544014 missense possibly damaging 0.68
R6949:Rexo1 UTSW 10 80550636 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- GGTCTTGGCATCTTCTCGGATC -3'
(R):5'- ACCTTGTGGACACGAGCATC -3'

Sequencing Primer
(F):5'- TCTTCCAGATGACAAGGTGC -3'
(R):5'- ACGTGCAGGCTGTCTTGC -3'
Posted On2014-06-23