Incidental Mutation 'R1807:Nfic'
ID203550
Institutional Source Beutler Lab
Gene Symbol Nfic
Ensembl Gene ENSMUSG00000055053
Gene Namenuclear factor I/C
Synonymsnuclear factor 1-C2, 1110019L22Rik, NF1-C, 1500041O16Rik
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R1807 (G1)
Quality Score202
Status Validated
Chromosome10
Chromosomal Location81396186-81455635 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 81404985 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 328 (T328A)
Ref Sequence ENSEMBL: ENSMUSP00000077317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020461] [ENSMUST00000078185] [ENSMUST00000105321] [ENSMUST00000117966] [ENSMUST00000221817]
Predicted Effect probably benign
Transcript: ENSMUST00000020461
AA Change: T370A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000020461
Gene: ENSMUSG00000055053
AA Change: T370A

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 7 47 4.6e-30 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 428 2e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078185
AA Change: T328A

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000077317
Gene: ENSMUSG00000055053
AA Change: T328A

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 9.5e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 323 1.4e-52 PFAM
Pfam:CTF_NFI 316 387 1.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105321
AA Change: T370A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000100958
Gene: ENSMUSG00000055053
AA Change: T370A

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 4 47 8e-31 PFAM
DWA 68 176 5.77e-24 SMART
Pfam:CTF_NFI 217 426 5.2e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117966
AA Change: T361A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113046
Gene: ENSMUSG00000055053
AA Change: T361A

DomainStartEndE-ValueType
Pfam:NfI_DNAbd_pre-N 1 38 1.3e-27 PFAM
DWA 59 167 5.77e-24 SMART
Pfam:CTF_NFI 208 421 1.9e-106 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000140916
AA Change: T37A
SMART Domains Protein: ENSMUSP00000114469
Gene: ENSMUSG00000055053
AA Change: T37A

DomainStartEndE-ValueType
Pfam:CTF_NFI 1 33 5.9e-12 PFAM
Pfam:CTF_NFI 29 93 1.3e-29 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152670
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156260
Predicted Effect probably benign
Transcript: ENSMUST00000221817
AA Change: T392A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CTF/NF-I family. These are dimeric DNA-binding proteins, and function as cellular transcription factors and as replication factors for adenovirus DNA replication. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null allele have abnormal incisor and molar root development, show reduced alveolar bone formation, and exhibit impaired feeding leading to severe runting and premature death when reared on standard laboratory chow. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Drd2 C T 9: 49,405,067 L376F probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Erbb2 T C 11: 98,428,854 Y591H probably damaging Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kif21b T A 1: 136,147,793 N219K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Me1 T A 9: 86,650,879 T197S probably damaging Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Recql5 T C 11: 115,895,115 K611E possibly damaging Het
Rexo1 A T 10: 80,542,579 I1180N possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Nfic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Nfic APN 10 81408220 missense possibly damaging 0.94
IGL01486:Nfic APN 10 81407644 unclassified probably null
IGL01784:Nfic APN 10 81406148 missense possibly damaging 0.70
IGL02053:Nfic APN 10 81420551 missense probably damaging 1.00
IGL03128:Nfic APN 10 81406191 missense probably benign 0.21
R0113:Nfic UTSW 10 81420585 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1468:Nfic UTSW 10 81420580 missense probably damaging 1.00
R1872:Nfic UTSW 10 81420684 missense possibly damaging 0.89
R2295:Nfic UTSW 10 81420531 missense probably damaging 1.00
R2324:Nfic UTSW 10 81406087 critical splice donor site probably null
R5992:Nfic UTSW 10 81420747 missense probably damaging 1.00
R6260:Nfic UTSW 10 81420517 nonsense probably null
R6972:Nfic UTSW 10 81420357 missense probably benign 0.00
R6982:Nfic UTSW 10 81420800 critical splice acceptor site probably null
X0065:Nfic UTSW 10 81427098 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTTACTACCAGAGCATGCAGC -3'
(R):5'- CTCTTTGTGGAAAGGGCCTG -3'

Sequencing Primer
(F):5'- AGGCTGCTCACGGTGACTG -3'
(R):5'- TGTGAGGCACAGAGCTGC -3'
Posted On2014-06-23