Incidental Mutation 'R1807:Erbb2'
ID203556
Institutional Source Beutler Lab
Gene Symbol Erbb2
Ensembl Gene ENSMUSG00000062312
Gene Nameerb-b2 receptor tyrosine kinase 2
Synonymsc-erbB2, c-neu, HER-2, HER2, Neu, ErbB-2, Neu oncogene
MMRRC Submission 039836-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1807 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location98412470-98437716 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98428854 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 591 (Y591H)
Ref Sequence ENSEMBL: ENSMUSP00000053897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058295]
Predicted Effect probably damaging
Transcript: ENSMUST00000058295
AA Change: Y591H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000053897
Gene: ENSMUSG00000062312
AA Change: Y591H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Recep_L_domain 52 174 2e-32 PFAM
FU 190 231 1.88e1 SMART
FU 233 276 1.03e-6 SMART
Pfam:Recep_L_domain 367 487 2.3e-23 PFAM
FU 502 551 3.08e-5 SMART
FU 558 607 3.97e-8 SMART
transmembrane domain 654 676 N/A INTRINSIC
TyrKc 721 977 1.28e-126 SMART
low complexity region 1040 1080 N/A INTRINSIC
low complexity region 1148 1163 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138066
Meta Mutation Damage Score 0.186 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.7%
Validation Efficiency 97% (77/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the epidermal growth factor (EGF) receptor family of receptor tyrosine kinases. This protein has no ligand binding domain of its own and therefore cannot bind growth factors. However, it does bind tightly to other ligand-bound EGF receptor family members to form a heterodimer, stabilizing ligand binding and enhancing kinase-mediated activation of downstream signalling pathways, such as those involving mitogen-activated protein kinase and phosphatidylinositol-3 kinase. Allelic variations at amino acid positions 654 and 655 of isoform a (positions 624 and 625 of isoform b) have been reported, with the most common allele, Ile654/Ile655, shown here. Amplification and/or overexpression of this gene has been reported in numerous cancers, including breast and ovarian tumors. Alternative splicing results in several additional transcript variants, some encoding different isoforms and others that have not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit degeneration of motor nerves, an absence of Schwann cells, impairment of junctional folds at the neuromuscular synapse, and cardiac defects that results in lethality by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061I04Rik C T 17: 35,895,069 W27* probably null Het
4933425L06Rik A T 13: 105,082,236 Q26L probably benign Het
4933430I17Rik T A 4: 62,542,756 Y289* probably null Het
8430408G22Rik G A 6: 116,651,722 V9M possibly damaging Het
A3galt2 A G 4: 128,767,601 I348V probably benign Het
Abca13 A G 11: 9,291,755 Y1206C probably damaging Het
Adar T C 3: 89,734,865 S18P probably benign Het
Akr1cl T C 1: 65,021,947 D139G possibly damaging Het
Aldh1b1 A G 4: 45,802,873 Y137C possibly damaging Het
Arsa T C 15: 89,475,322 M86V possibly damaging Het
Atg9b C A 5: 24,387,057 R648L probably damaging Het
Atrn A G 2: 130,982,772 N1042S possibly damaging Het
Ccdc130 C T 8: 84,260,307 R187Q probably damaging Het
Ccdc6 T A 10: 70,175,159 D325E possibly damaging Het
Cdk12 T C 11: 98,210,377 S354P unknown Het
Chst3 T A 10: 60,186,308 Y239F probably benign Het
Cilp2 C A 8: 69,882,194 R718L probably damaging Het
Col27a1 A G 4: 63,331,349 probably benign Het
Ctbp2 T C 7: 133,014,408 N266S probably benign Het
Ctnnd2 T C 15: 30,619,871 V123A probably damaging Het
D7Ertd443e T A 7: 134,293,305 E552V probably null Het
Dcst1 T A 3: 89,353,541 H516L probably damaging Het
Drd2 C T 9: 49,405,067 L376F probably damaging Het
Edn1 A G 13: 42,306,794 N175S probably damaging Het
Eipr1 G T 12: 28,766,839 G65V probably damaging Het
Epha4 G A 1: 77,374,904 P905S probably benign Het
Fam135b G A 15: 71,463,912 R478C probably benign Het
Fam49a G A 12: 12,361,504 R123Q probably benign Het
Fat2 T C 11: 55,289,259 T1419A probably damaging Het
Flnb C T 14: 7,934,645 T2239I probably benign Het
Gm7713 T C 15: 59,994,471 noncoding transcript Het
Gm9008 A G 6: 76,497,414 V73A probably benign Het
Hsf5 C T 11: 87,657,342 P617L probably benign Het
Kcnk12 C A 17: 87,746,040 R398L probably benign Het
Kif21b T A 1: 136,147,793 N219K possibly damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Klra5 A T 6: 129,899,420 F141L probably benign Het
Lmtk3 C T 7: 45,793,278 P462S probably benign Het
Mast2 A G 4: 116,310,741 probably benign Het
Me1 T A 9: 86,650,879 T197S probably damaging Het
Msr1 T A 8: 39,619,907 Q267L probably benign Het
Nfic T C 10: 81,404,985 T328A probably benign Het
Nphp3 G A 9: 104,020,741 D390N probably benign Het
Nr2e1 T A 10: 42,582,909 probably null Het
Olfr1094 T A 2: 86,829,101 F116L probably benign Het
Olfr603 T A 7: 103,383,583 N140Y probably benign Het
Pard6b T C 2: 168,087,412 L46P probably damaging Het
Prkaa1 T A 15: 5,143,954 L20Q probably damaging Het
Rapgefl1 T C 11: 98,845,989 probably null Het
Recql5 T C 11: 115,895,115 K611E possibly damaging Het
Rexo1 A T 10: 80,542,579 I1180N possibly damaging Het
Rph3a T C 5: 120,945,393 N605D probably damaging Het
Sema6a A G 18: 47,276,424 V592A possibly damaging Het
Skint11 A T 4: 114,194,696 R80S probably benign Het
Smpdl3a C A 10: 57,801,022 P72H probably damaging Het
Sobp T G 10: 43,160,826 M39L possibly damaging Het
Sparcl1 T A 5: 104,085,761 Y574F probably damaging Het
Spns3 C T 11: 72,538,340 W206* probably null Het
Srf A G 17: 46,553,759 V190A possibly damaging Het
Stag1 T G 9: 100,908,666 H742Q probably benign Het
Strn3 A T 12: 51,627,203 S542T probably benign Het
Synpo2 T C 3: 123,080,257 E1020G possibly damaging Het
Tcerg1l T A 7: 138,395,097 H137L probably benign Het
Tlr12 A T 4: 128,617,436 D340E probably benign Het
Tmem130 T A 5: 144,755,364 T77S probably benign Het
Tmem143 C A 7: 45,897,613 R68S probably damaging Het
Tnrc6a CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT CTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTTTTGTT 7: 123,162,446 probably benign Het
Trem1 G T 17: 48,241,635 G67* probably null Het
Tsc1 A G 2: 28,686,113 D978G probably benign Het
Txndc9 A T 1: 37,994,015 H95Q probably damaging Het
Zfp35 T A 18: 24,003,929 N443K probably benign Het
Other mutations in Erbb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Erbb2 APN 11 98435630 missense probably damaging 1.00
IGL01460:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01483:Erbb2 APN 11 98434539 missense probably damaging 1.00
IGL01514:Erbb2 APN 11 98432919 missense possibly damaging 0.94
IGL01520:Erbb2 APN 11 98434009 missense probably benign 0.05
IGL03007:Erbb2 APN 11 98428993 splice site probably benign
IGL03367:Erbb2 APN 11 98422875 splice site probably null
Angular UTSW 11 98422770 missense probably damaging 0.98
PIT4544001:Erbb2 UTSW 11 98421039 missense probably benign
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0234:Erbb2 UTSW 11 98436439 missense probably benign 0.33
R0388:Erbb2 UTSW 11 98427351 missense possibly damaging 0.66
R0602:Erbb2 UTSW 11 98434271 missense probably damaging 1.00
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1467:Erbb2 UTSW 11 98436175 nonsense probably null
R1500:Erbb2 UTSW 11 98428978 missense probably damaging 1.00
R1651:Erbb2 UTSW 11 98433457 missense probably damaging 1.00
R1748:Erbb2 UTSW 11 98435335 missense probably benign 0.06
R1861:Erbb2 UTSW 11 98412737 critical splice donor site probably null
R1926:Erbb2 UTSW 11 98425164 missense probably benign
R1998:Erbb2 UTSW 11 98428953 missense probably damaging 1.00
R2051:Erbb2 UTSW 11 98420172 missense probably damaging 1.00
R3147:Erbb2 UTSW 11 98434039 missense probably damaging 1.00
R4022:Erbb2 UTSW 11 98435297 missense probably benign 0.09
R4238:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4239:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4240:Erbb2 UTSW 11 98428043 missense probably benign 0.01
R4633:Erbb2 UTSW 11 98432988 missense possibly damaging 0.91
R4725:Erbb2 UTSW 11 98425144 missense possibly damaging 0.71
R5093:Erbb2 UTSW 11 98427453 missense probably damaging 1.00
R5306:Erbb2 UTSW 11 98428206 missense probably benign 0.44
R5375:Erbb2 UTSW 11 98433412 missense probably damaging 1.00
R5518:Erbb2 UTSW 11 98422770 missense probably damaging 0.98
R5710:Erbb2 UTSW 11 98427080 missense probably damaging 1.00
R5938:Erbb2 UTSW 11 98435571 missense probably damaging 0.99
R6062:Erbb2 UTSW 11 98433249 missense probably damaging 1.00
R6116:Erbb2 UTSW 11 98427399 missense probably damaging 1.00
R6514:Erbb2 UTSW 11 98420146 missense probably benign 0.03
R6556:Erbb2 UTSW 11 98436082 missense possibly damaging 0.92
R6570:Erbb2 UTSW 11 98423047 missense possibly damaging 0.88
R6578:Erbb2 UTSW 11 98428188 missense probably damaging 1.00
R7141:Erbb2 UTSW 11 98427309 missense probably damaging 1.00
X0028:Erbb2 UTSW 11 98434301 missense probably damaging 1.00
X0062:Erbb2 UTSW 11 98423120 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTCACTTCCTTGTTGAGAGCAG -3'
(R):5'- AAGTGAACGTAGACTTCTGCCC -3'

Sequencing Primer
(F):5'- CAGGGATGTTTACTCCAGGATCAG -3'
(R):5'- TTCTGCCCCTTTCACAACAAGAG -3'
Posted On2014-06-23