Incidental Mutation 'R1808:Pdss1'
ID203577
Institutional Source Beutler Lab
Gene Symbol Pdss1
Ensembl Gene ENSMUSG00000026784
Gene Nameprenyl (solanesyl) diphosphate synthase, subunit 1
Synonyms2610203G20Rik, Tprt, mSPS1, 2700031G06Rik
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location22895522-22940266 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 22906834 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 120 (E120*)
Ref Sequence ENSEMBL: ENSMUSP00000121873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053729] [ENSMUST00000141215] [ENSMUST00000152170]
Predicted Effect probably null
Transcript: ENSMUST00000053729
AA Change: E120*
SMART Domains Protein: ENSMUSP00000055689
Gene: ENSMUSG00000026784
AA Change: E120*

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 117 366 1.5e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122676
Predicted Effect probably benign
Transcript: ENSMUST00000141215
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148072
Predicted Effect probably null
Transcript: ENSMUST00000152170
AA Change: E120*
SMART Domains Protein: ENSMUSP00000121873
Gene: ENSMUSG00000026784
AA Change: E120*

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:polyprenyl_synt 114 276 6e-35 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an enzyme that elongates the prenyl side-chain of coenzyme Q, or ubiquinone, one of the key elements in the respiratory chain. The gene product catalyzes the formation of all trans-polyprenyl pyrophosphates from isopentyl diphosphate in the assembly of polyisoprenoid side chains, the first step in coenzyme Q biosynthesis. The protein may be peripherally associated with the inner mitochondrial membrane, though no transit peptide has been definitively identified to date. Defects in this gene are a cause of coenzyme Q10 deficiency. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Pdss1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01419:Pdss1 APN 2 22935577 missense possibly damaging 0.49
IGL02512:Pdss1 APN 2 22912646 missense probably damaging 1.00
IGL02691:Pdss1 APN 2 22915241 missense probably benign
LCD18:Pdss1 UTSW 2 22900968 intron probably benign
R0190:Pdss1 UTSW 2 22906831 missense probably damaging 0.97
R0576:Pdss1 UTSW 2 22915413 critical splice acceptor site probably null
R0732:Pdss1 UTSW 2 22901312 missense probably benign 0.00
R1682:Pdss1 UTSW 2 22915519 missense probably damaging 1.00
R2430:Pdss1 UTSW 2 22929593 nonsense probably null
R2937:Pdss1 UTSW 2 22906787 splice site probably null
R2938:Pdss1 UTSW 2 22906787 splice site probably null
R4181:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4302:Pdss1 UTSW 2 22915505 missense probably damaging 1.00
R4323:Pdss1 UTSW 2 22912596 splice site probably benign
R5076:Pdss1 UTSW 2 22899917 critical splice acceptor site probably null
R5108:Pdss1 UTSW 2 22906883 missense possibly damaging 0.94
R6333:Pdss1 UTSW 2 22901766 missense probably damaging 1.00
R7138:Pdss1 UTSW 2 22912669 missense probably damaging 1.00
R7286:Pdss1 UTSW 2 22935641 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATACCATACCACTTGGGGCAAAG -3'
(R):5'- GTCTAGTGAAGTCTTAGATGCGC -3'

Sequencing Primer
(F):5'- GCAAAGCCACACATTCTTTTTG -3'
(R):5'- AGATGCGCTTCTTAAGTGAGC -3'
Posted On2014-06-23