Incidental Mutation 'R1808:Olfr507'
ID203602
Institutional Source Beutler Lab
Gene Symbol Olfr507
Ensembl Gene ENSMUSG00000061000
Gene Nameolfactory receptor 507
SynonymsGA_x6K02T2PBJ9-10951546-10952496, MOR204-7
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location108621814-108622764 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 108622610 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 266 (K266T)
Ref Sequence ENSEMBL: ENSMUSP00000078926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080014
AA Change: K266T

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000078926
Gene: ENSMUSG00000061000
AA Change: K266T

DomainStartEndE-ValueType
Pfam:7tm_4 34 313 6.1e-52 PFAM
Pfam:7tm_1 44 295 1e-20 PFAM
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Olfr507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Olfr507 APN 7 108621857 missense probably damaging 1.00
IGL01979:Olfr507 APN 7 108622441 missense probably benign 0.09
IGL02373:Olfr507 APN 7 108622103 missense probably benign 0.11
IGL02754:Olfr507 APN 7 108622673 missense possibly damaging 0.94
IGL03008:Olfr507 APN 7 108622283 missense probably damaging 0.99
R0305:Olfr507 UTSW 7 108622585 missense probably benign 0.01
R0584:Olfr507 UTSW 7 108622415 missense probably benign 0.00
R0611:Olfr507 UTSW 7 108622287 missense possibly damaging 0.72
R0947:Olfr507 UTSW 7 108622672 missense probably benign 0.02
R1488:Olfr507 UTSW 7 108622489 missense probably damaging 1.00
R3763:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R4367:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4369:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4371:Olfr507 UTSW 7 108621889 missense probably benign 0.27
R4609:Olfr507 UTSW 7 108622504 missense probably benign 0.35
R5389:Olfr507 UTSW 7 108622717 missense probably damaging 1.00
R6499:Olfr507 UTSW 7 108622506 missense probably benign 0.02
R6684:Olfr507 UTSW 7 108621934 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGATAACAGTGTCCTGCTAATTCTTG -3'
(R):5'- TGTGACAAACAGTGTAGCAGAC -3'

Sequencing Primer
(F):5'- GCTGGCTCCATCATTGTGATCAC -3'
(R):5'- CAAACAGTGTAGCAGACAAGTC -3'
Posted On2014-06-23