Incidental Mutation 'R1808:Slc10a2'
ID203605
Institutional Source Beutler Lab
Gene Symbol Slc10a2
Ensembl Gene ENSMUSG00000023073
Gene Namesolute carrier family 10, member 2
SynonymsASBT
MMRRC Submission 039837-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location5083219-5105351 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 5104856 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 110 (T110A)
Ref Sequence ENSEMBL: ENSMUSP00000023835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023835]
Predicted Effect probably damaging
Transcript: ENSMUST00000023835
AA Change: T110A

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023835
Gene: ENSMUSG00000023073
AA Change: T110A

DomainStartEndE-ValueType
Pfam:SBF 39 220 1e-47 PFAM
transmembrane domain 226 248 N/A INTRINSIC
transmembrane domain 286 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sodium/bile acid cotransporter. This transporter is the primary mechanism for uptake of intestinal bile acids by apical cells in the distal ileum. Bile acids are the catabolic product of cholesterol metabolism, so this protein is also critical for cholesterol homeostasis. Mutations in this gene cause primary bile acid malabsorption (PBAM); muatations in this gene may also be associated with other diseases of the liver and intestines, such as familial hypertriglyceridemia (FHTG). [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene are essentially indistinguishable from wild-type in terms of survival, gross appearance and behavior. However, they do have defects in lipid absorption from the intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Nek1 A G 8: 61,016,230 D107G probably damaging Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Slc10a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Slc10a2 APN 8 5091668 missense probably damaging 0.96
IGL00504:Slc10a2 APN 8 5091667 missense probably benign 0.00
IGL00596:Slc10a2 APN 8 5091680 missense probably benign 0.00
IGL01472:Slc10a2 APN 8 5091652 missense probably damaging 1.00
IGL02679:Slc10a2 APN 8 5098499 missense probably damaging 1.00
gall UTSW 8 5091621 critical splice donor site probably null
R0560:Slc10a2 UTSW 8 5089092 missense probably benign 0.02
R0629:Slc10a2 UTSW 8 5098562 missense probably benign 0.30
R0743:Slc10a2 UTSW 8 5089132 missense probably damaging 0.99
R0970:Slc10a2 UTSW 8 5105115 missense probably benign 0.00
R1033:Slc10a2 UTSW 8 5104889 missense probably damaging 0.99
R1557:Slc10a2 UTSW 8 5091755 missense probably damaging 1.00
R3620:Slc10a2 UTSW 8 5104909 missense probably damaging 0.99
R4084:Slc10a2 UTSW 8 5089126 missense possibly damaging 0.71
R4112:Slc10a2 UTSW 8 5105135 missense probably benign
R5693:Slc10a2 UTSW 8 5105128 missense probably damaging 1.00
R6294:Slc10a2 UTSW 8 5091621 critical splice donor site probably null
R6459:Slc10a2 UTSW 8 5098581 splice site probably null
R7442:Slc10a2 UTSW 8 5089086 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGCACATGGATGCACTTACTC -3'
(R):5'- CACCATCCTCTTAGCCATGG -3'

Sequencing Primer
(F):5'- ACATGGATGCACTTACTCTTCCC -3'
(R):5'- ATCCTCTTAGCCATGGTGATG -3'
Posted On2014-06-23