Incidental Mutation 'R1808:Nek1'
ID203606
Institutional Source Beutler Lab
Gene Symbol Nek1
Ensembl Gene ENSMUSG00000031644
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 1
Synonymskidney, anemia and testis, kat, D8Ertd790e
MMRRC Submission 039837-MU
Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1808 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location60993195-61131346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61016230 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 107 (D107G)
Ref Sequence ENSEMBL: ENSMUSP00000147258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]
Predicted Effect probably damaging
Transcript: ENSMUST00000034065
AA Change: D107G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: D107G

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 556 592 N/A INTRINSIC
coiled coil region 647 685 N/A INTRINSIC
low complexity region 767 780 N/A INTRINSIC
low complexity region 1130 1141 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120689
AA Change: D107G

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: D107G

DomainStartEndE-ValueType
S_TKc 4 258 4.23e-95 SMART
Blast:S_TKc 266 303 3e-7 BLAST
low complexity region 321 337 N/A INTRINSIC
coiled coil region 372 402 N/A INTRINSIC
coiled coil region 487 510 N/A INTRINSIC
low complexity region 521 533 N/A INTRINSIC
coiled coil region 584 620 N/A INTRINSIC
coiled coil region 675 713 N/A INTRINSIC
low complexity region 795 808 N/A INTRINSIC
low complexity region 1158 1169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125717
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155664
Predicted Effect probably damaging
Transcript: ENSMUST00000211256
AA Change: D107G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect possibly damaging
Transcript: ENSMUST00000211672
AA Change: D107G

PolyPhen 2 Score 0.629 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik G T 5: 146,184,881 Y69* probably null Het
2310011J03Rik A G 10: 80,320,181 probably null Het
A2ml1 A C 6: 128,543,299 D1367E probably damaging Het
Adam6a C G 12: 113,544,714 L236V probably benign Het
Arf3 T C 15: 98,741,073 N101S probably benign Het
Arhgap42 T C 9: 9,180,050 E76G probably damaging Het
Atp2a1 A G 7: 126,453,401 F382S probably damaging Het
Bud13 T A 9: 46,288,407 F355L probably benign Het
C2 G A 17: 34,864,532 P349S probably damaging Het
Cbl C A 9: 44,164,229 G373V probably damaging Het
Ccdc3 T A 2: 5,138,085 L51Q probably damaging Het
Ccdc34 T A 2: 110,044,256 M320K probably benign Het
Cntln A G 4: 85,096,763 E1097G probably damaging Het
Ctsc A C 7: 88,299,542 K195Q possibly damaging Het
Ctsf C T 19: 4,856,534 P163L probably benign Het
Dcxr A T 11: 120,725,612 probably null Het
Dgki T C 6: 37,149,574 E157G possibly damaging Het
Dnah8 T C 17: 30,684,186 L933P probably damaging Het
Dtna T C 18: 23,569,640 L76P probably damaging Het
Fcgbp T A 7: 28,085,090 C192S probably benign Het
Galnt5 T A 2: 58,026,125 D683E probably benign Het
Greb1l G A 18: 10,542,143 A1297T probably benign Het
Grik4 T C 9: 42,629,026 N286S probably benign Het
Hrc A T 7: 45,336,778 E451V probably damaging Het
Hrh3 G A 2: 180,099,784 probably benign Het
Ints13 A G 6: 146,554,197 I152T probably damaging Het
Irgm1 A T 11: 48,866,432 V184D probably damaging Het
Itga5 C T 15: 103,350,399 A791T probably damaging Het
Kcp T C 6: 29,505,655 T73A probably benign Het
Kidins220 A G 12: 25,003,009 T433A probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Kmt2d T C 15: 98,866,686 D12G probably damaging Het
Mms19 A G 19: 41,966,259 S74P probably damaging Het
Myh1 G T 11: 67,211,474 E864* probably null Het
Npc1 T C 18: 12,194,092 N1149D probably damaging Het
Olfr127 T A 17: 37,903,770 S75T probably damaging Het
Olfr1280 T C 2: 111,315,998 V173A probably benign Het
Olfr401 C A 11: 74,121,431 S47R probably damaging Het
Olfr507 A C 7: 108,622,610 K266T possibly damaging Het
Osbp T C 19: 11,970,778 S150P probably damaging Het
Paf1 T C 7: 28,396,822 Y287H probably damaging Het
Pdgfrb T C 18: 61,068,102 V420A probably benign Het
Pdss1 G T 2: 22,906,834 E120* probably null Het
Pink1 A T 4: 138,317,319 V339E probably damaging Het
Pkn3 C T 2: 30,079,651 R58C probably damaging Het
Pm20d1 G A 1: 131,802,427 V235I probably benign Het
Ppp2r2a A G 14: 67,038,963 I31T probably damaging Het
Rbms3 T C 9: 116,822,826 E152G probably damaging Het
Rfx1 A C 8: 84,095,048 Q804H probably damaging Het
Rpe G T 1: 66,715,197 V143L probably benign Het
Sap30l G T 11: 57,809,945 V142L probably benign Het
Sh3tc1 T C 5: 35,705,924 Q973R probably benign Het
Slc10a2 T C 8: 5,104,856 T110A probably damaging Het
Snrnp200 A T 2: 127,219,027 probably null Het
Snrnp200 G A 2: 127,219,028 probably null Het
Spaca3 T A 11: 80,867,685 V158E probably damaging Het
Sprtn C A 8: 124,903,031 N354K probably benign Het
Stab1 T A 14: 31,141,144 Y2166F possibly damaging Het
Tmem106c G A 15: 97,968,667 probably null Het
Tnc A G 4: 63,999,931 S1248P probably damaging Het
Tshr T C 12: 91,537,316 F343L probably benign Het
Ttn C A 2: 76,725,354 A30436S probably damaging Het
Ubxn2a A T 12: 4,885,839 M68K probably benign Het
Ucp2 T C 7: 100,498,814 V238A probably damaging Het
Urgcp C A 11: 5,717,242 L365F probably damaging Het
Vezt A T 10: 93,990,164 D328E probably damaging Het
Vmn1r168 G T 7: 23,540,759 V14L probably benign Het
Vps13b T C 15: 35,792,059 F2158L probably benign Het
Other mutations in Nek1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Nek1 APN 8 61043284 missense probably benign 0.00
IGL01075:Nek1 APN 8 61124132 missense possibly damaging 0.64
IGL01122:Nek1 APN 8 61120966 missense possibly damaging 0.80
IGL01151:Nek1 APN 8 61020077 missense probably damaging 1.00
IGL01286:Nek1 APN 8 61124216 missense possibly damaging 0.64
IGL01377:Nek1 APN 8 61089456 missense probably benign
IGL01485:Nek1 APN 8 61049826 missense probably benign 0.02
IGL01688:Nek1 APN 8 61105597 nonsense probably null
IGL01806:Nek1 APN 8 61124212 missense possibly damaging 0.82
IGL02006:Nek1 APN 8 61104192 missense probably benign 0.20
IGL02304:Nek1 APN 8 61012167 missense probably damaging 1.00
IGL02659:Nek1 APN 8 61089480 missense probably benign 0.16
IGL02662:Nek1 APN 8 61104184 missense probably benign 0.00
IGL02801:Nek1 APN 8 61121061 critical splice donor site probably null
IGL02806:Nek1 APN 8 61044086 missense probably benign 0.15
IGL03037:Nek1 APN 8 61034052 missense probably benign 0.16
IGL03252:Nek1 APN 8 61072330 nonsense probably null
P0014:Nek1 UTSW 8 61071747 splice site probably benign
R0019:Nek1 UTSW 8 61089734 missense probably benign 0.01
R0403:Nek1 UTSW 8 61106855 missense probably damaging 0.99
R0464:Nek1 UTSW 8 61072273 splice site probably benign
R0726:Nek1 UTSW 8 61089592 missense probably damaging 1.00
R0761:Nek1 UTSW 8 61089455 missense probably benign
R0827:Nek1 UTSW 8 61105648 splice site probably benign
R0972:Nek1 UTSW 8 61089431 splice site probably null
R1268:Nek1 UTSW 8 61022264 missense probably damaging 1.00
R1343:Nek1 UTSW 8 61028675 missense probably damaging 1.00
R1415:Nek1 UTSW 8 61089686 missense probably benign 0.00
R1466:Nek1 UTSW 8 61125136 splice site probably benign
R1480:Nek1 UTSW 8 61124326 splice site probably null
R1526:Nek1 UTSW 8 61049941 missense probably benign 0.26
R1552:Nek1 UTSW 8 61006737 missense probably damaging 0.99
R1606:Nek1 UTSW 8 61124276 missense possibly damaging 0.82
R1650:Nek1 UTSW 8 61036076 missense probably benign 0.00
R1757:Nek1 UTSW 8 61089813 splice site probably null
R1966:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R2067:Nek1 UTSW 8 61007162 missense probably damaging 1.00
R2111:Nek1 UTSW 8 61124326 splice site probably null
R2113:Nek1 UTSW 8 61016293 missense probably damaging 1.00
R2143:Nek1 UTSW 8 61028696 missense probably damaging 1.00
R2255:Nek1 UTSW 8 61089773 missense probably damaging 1.00
R2422:Nek1 UTSW 8 61019901 missense probably damaging 1.00
R3848:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3849:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R3850:Nek1 UTSW 8 61072315 missense probably damaging 0.99
R4418:Nek1 UTSW 8 61106864 missense probably damaging 1.00
R4526:Nek1 UTSW 8 61106944 missense probably damaging 0.99
R4533:Nek1 UTSW 8 61007213 missense possibly damaging 0.95
R4544:Nek1 UTSW 8 61016304 nonsense probably null
R4677:Nek1 UTSW 8 61028806 missense probably damaging 0.99
R4739:Nek1 UTSW 8 61098511 missense probably benign 0.32
R5068:Nek1 UTSW 8 61016296 missense probably damaging 1.00
R5421:Nek1 UTSW 8 61006677 missense possibly damaging 0.81
R5516:Nek1 UTSW 8 61089489 missense probably benign 0.03
R5855:Nek1 UTSW 8 61016272 missense probably damaging 1.00
R6125:Nek1 UTSW 8 61028701 missense probably damaging 1.00
R6267:Nek1 UTSW 8 61072309 nonsense probably null
R6292:Nek1 UTSW 8 61054736 intron probably null
R6296:Nek1 UTSW 8 61072309 nonsense probably null
R6458:Nek1 UTSW 8 61100012 missense probably benign 0.00
R6568:Nek1 UTSW 8 61106821 missense probably benign 0.00
R6629:Nek1 UTSW 8 61054333 intron probably null
R6867:Nek1 UTSW 8 61072330 missense possibly damaging 0.81
R7122:Nek1 UTSW 8 61106795 missense probably benign 0.00
R7193:Nek1 UTSW 8 61073578 missense probably damaging 0.99
R7272:Nek1 UTSW 8 61125086 missense probably benign 0.34
R7356:Nek1 UTSW 8 61120960 missense probably benign 0.02
R7368:Nek1 UTSW 8 61089707 missense probably benign 0.24
R7478:Nek1 UTSW 8 61130145 missense probably benign 0.03
R7479:Nek1 UTSW 8 61130145 missense probably benign 0.03
X0028:Nek1 UTSW 8 61043258 missense probably benign 0.19
X0066:Nek1 UTSW 8 61125128 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATTACTTGGTCTGAAGAGTGAGG -3'
(R):5'- CATCGGGTATCTGAGTGAGC -3'

Sequencing Primer
(F):5'- GCCCAACAAACTTATCTGCCTATTAC -3'
(R):5'- TGGCATAGAGGCTCACACTGTAATC -3'
Posted On2014-06-23